Labshake search
Citations for New England Biolabs :
1 - 50 of 976 citations for Dl 4 Methoxyestradiol 13 14 15 16 17 18 13C6 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Microbiology 2020Quote: ... 14-17 A260 of lysate was digested with 800 U/A260 of micrococcal nuclease (MNase, NEB) at 25°C with shaking at 14,500 rpm for 20 min in lysis buffer supplemented with 2 mM CaCl2 and 500 U RNase Inhibitor ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex, Deduped and Fivepercent methods and 10 for Illumina and 13 for NEB). We normalized the data using the DESeq2(40 ...
-
bioRxiv - Microbiology 2022Quote: ... the above construct was amplified using primers 17 and 18 and integrated into BamHI/PacI-digested (NEB) pUPRT plasmid by Gibson assembly ...
-
bioRxiv - Bioengineering 2021Quote: ... dsDNA fragments were inserted into PCR-amplified (primers 17-18 in Table S3) and purified pRSET vector fragment by Gibson Assembly (NEB, USA) to add sequence parts necessary for cDNA display generation to the DNA library ...
-
bioRxiv - Cancer Biology 2020Quote: ... extra Biotin-14-dATP was first removed using 15 units of T4 DNA polymerase (NEB) and incubating at 20°C for 4 hours ...
-
bioRxiv - Microbiology 2020Quote: ... pCrPV-1A-DcDV was linearized by inverse PCR with primers 17 and 18 and the linearized plasmid was circularized by blunt end ligation with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts) according to the manufacturer’s instructions to create pCrPV-1A-DcDV-1A ...
-
bioRxiv - Neuroscience 2020Quote: ... either purified directly (insert) or from agarose gel (vector) and ligated (16-18 h, 20-22 °C) with T4 DNA ligase (NEB) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2024Quote: ... Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, cat# E7300S). Small RNA PCR amplicons were size selected on 10% polyacrylamide non-denaturing gels ...
-
bioRxiv - Genomics 2022Quote: ... 16 µl RNA were mixed with 4 µl LunaScript master mix (NEB cat# E3010L), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... at 16 °C overnight, followed by heat-inactivation (65°C, 15 min) and linearization using SbfI-HF (NEB) at 37°C for 2 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR product was denatured and annealed in an 18 μl reaction (15 μl PCR product, 2 μl NEB Buffer2 (10X), 1 μl nuclease-free H2O ...
-
bioRxiv - Microbiology 2023Quote: ... using JLHP836/838 and cloned into BamHI and NheI digested pDSW1278 (15) by Gibson assembly (16) using NEBuilder HiFi DNA Assembly Master Mix (NEB). This plasmid was conjugated into C ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplification was performed using NEB primers for 15-16 cycles using the Q5 Hot Start HiFi PCR Master Mix (NEB). The PCR-amplified library was purified using Ampure XP beads and its quality was assessed on a Bioanalyzer 2100 system (Agilent) ...
-
Broad variation in response of individual introns to splicing inhibitors in a humanized yeast strainbioRxiv - Molecular Biology 2023Quote: ... This plasmid was cut with BaeI and a guide sequence DNA targeting the genomic region encoding Hsh155 HRs 15-16 region (Table S1) was inserted using HiFi DNA Assembly (New England BioLabs) to make p416-TEF1p-Cas9-NLS-crRNA-HSH155.
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Genetics 2019Quote: ... Exon 14b was amplified with primers F: GACATGTTGCTAAGATTGAAATCCGT from exon 14 and R: GACCCAGCTTTCAGAGTAACCAGAAC from exon 15 using Phusion polymerase (NEB, Ipswich, MA). The longer band containing exon14b was then excised from the gel and purified using Zymoclean gel DNA recovery kit (Zymoresearch ...
-
bioRxiv - Microbiology 2023Quote: ... DNase I (NEB; 18 U), and lysozyme (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... 15 µL of labeling mix (4 µL 10X ThermoPol Reaction buffer (NEB, B9004S), 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP ...
-
bioRxiv - Microbiology 2021Quote: ... The amplification of bacterial DNA was achieved by targeting the V3–V4 region of 16S rRNA gene with 30 µL final volume containing 15 µL of 2× master mix (BioLabs, USA), 3 µL of template DNA ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 18 μL 25 mM dNTPs (NEB), 30 μL 0.1 M DTT (Invitrogen) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SNAP-Surface Block at 13 μM (NEB) for 20 min at 25°C (for intracellular labeling ...
-
bioRxiv - Genomics 2024Quote: ... and 13% second strand synthesis enzyme mix (NEB) was added ...
-
bioRxiv - Genomics 2022Quote: ... the 1:99 target:background sample was digested with FspEI (New England Biolabs) according to the manufacturers protocol (incubation at 37°C for 90 minute ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was ligated by incubation at 16°C for 5h in 4 ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 14-cycle PCR with index primers (NEB) was performed (initial denaturation ...
-
bioRxiv - Biochemistry 2020Quote: 18 µg HindIII-digested lambda DNA (NEB N3012S) was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S ...
-
bioRxiv - Genetics 2019Quote: ... column-purified and transformed in 14 electroporations (NEB 10-beta Electrocompetent E ...
-
bioRxiv - Microbiology 2021Quote: ... 16 nM λ-DNA (NEB #N3011S) in 0.120 M NaCl was heated to 80°C for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Plant Biology 2021Quote: ... The cloning reaction consists of 25 cycles of 3 min at 37°C for digestion and 4 min at 16°C for ligation combining the restriction enzymes BsaI-HF (New England BioLabs, Ipswich, UK) for level 1 reaction or BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB] ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μM dNTP in 17 μL 1x rCutSmart buffer (NEB). The RNA and primers were then annealed by incubating as follows ...
-
bioRxiv - Biophysics 2019Quote: ... λ-DNA (16 nM, New England Biolabs) was first heated in presence of 120 mM Na+ at 80 oC for 10 min and then quenched on ice for 5 min ...
-
bioRxiv - Bioengineering 2021Quote: ... 16 U/mL Proteinase K (P8107S, NEB). The tissues were incubated at 37 °C for 40 min.
-
bioRxiv - Bioengineering 2021Quote: ... 16 U/mL Proteinase K (P8107S, NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... with supplements (16 U RNase inhibitor (NEB), 5 mM FMN) ...
-
bioRxiv - Systems Biology 2023Quote: ... 16 mU/uL proteinase K (NEB, P8107S)) ...
-
bioRxiv - Physiology 2024Quote: ... 16 U/mL Proteinase K (P8107S, NEB)) at 37 °C for 40 min ...
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Immunology 2023Quote: ... The libraries were generated by blunt-end cloning of 1,200 ng fragmented DNA into 1,000 ng PmeI linearized and dephosphorylated pHORF3 library vector (a gift from Michael Hust, Technische Universität Braunschweig) (16 hr at 16 °C, T4 DNA Ligase, NEB). The ligation reaction was purified and transformed into TG1 bacteria (Lucigen ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20 μl of each clean digestion product were split equally in two 0.2 ml PCR tubes (15 μl in each) and 4 μl of Adaptor ligation buffer (5x T4 DNA Ligase Buffer (New England Biolabs) and 10 μM of the dsAdR adaptor along with 1 μl (400 U ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation began with the digestion of 1pg–200 ng genomic DNA in a 15-µl reaction using 4 U BcgI (NEB) at 37 °C for 3 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 13 μl of 10× NEBuffer3.1 and 100 units of MboI (NEB, R0147M) were added and the chromatin was digested at 37 °C overnight while shaking ...
-
bioRxiv - Genomics 2023Quote: ... Then we added 13 μl of Q5 Ultra II (NEB, 2x mastermix), 1 μl S5 primer ...