Labshake search
Citations for New England Biolabs :
4701 - 4750 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... were amplified by PCR and cloned into the pX601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2021Quote: ... The product was cloned into a pSB3K3 vector using either NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) or the MEGAWHOP protocol54 based on a plasmid carrying the inactive variant E418A ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed in vitro transcription using the HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs), and purified the resulting RNA using a GeneJET RNA Purification Kit (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... In vitro transcription was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs (NEB)) as previously described (23) ...
-
bioRxiv - Bioengineering 2020Quote: ... In vitro transcription was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs (NEB)) as previously described (23) ...
-
bioRxiv - Biochemistry 2020Quote: ... The DNA was immediately purified using a DNA cleanup column (the Monarch PCR & DNA cleanup kit from NEB) and eluted with water ...
-
Persistent DNA damage rewires lipid metabolism and promotes histone hyperacetylation via MYS-1/Tip60bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were generated using NEBNext®Ultra™RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids encoding various dSARM1ARM mutants were generated using the Q5® Site-Direct Mutagenesis Kit (New England BioLabs). Plasmids were transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (#E7420, New England BioLabs) for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 8 μL of RNA was added per section to step 2.1 through to 2.11.11 of the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645L) following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing libraries were prepared with NEBNext® UltraTM II kit for Illumina (cat# E7645S) (New England Biolabs, MA) and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2021Quote: ... The K107E and ΔSTART mutations in PDF2 were generated using Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The L480P mutation in GL2 was generated by one-step PCR-based site-directed mutagenesis (Scott et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted using Monarch Total RNA Miniprep kit including DNAse treatment on column (New England Biolabs). m7G-RIP was then performed as previously described49 with slight modifications ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Microbiology 2020Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were created using NEBNext® Ultra(tm) Directional RNA Library Prep Kit (New England BioLabs, Frankfurt, Germany). Pooled libraries were loaded on the cBot (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries were prepared using the NEB Next Ultra DNA Library Prep kit for Illumina (New England BioLabs). Approximately 10 Gb were sequenced with a HiSeq X Ten instrument as paired-end 150 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs were synthesized from RNA using the LunaScript™ RT SuperMix Kit from New England BioLabs (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... then RNA-seq libraries were prepared using the NEBNext Ultra II Directional mRNA-seq kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... Ribo-depleted RNA was then prepared for sequencing using the NEBNext Ultra Directional RNA kit (NEB product E7420), and sequenced as described above for the DNA samples.
-
bioRxiv - Cancer Biology 2020Quote: ... site-directed mutagenesis was carried out using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat# E0554S) to introduce a stop codon ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutations were generated in pBridge-PIF3-N1 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The primers used to generate the m1 to m15 mutants are listed in Supplementary Table 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... The NCK2 SH3 shuffled chimeras were constructed using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Inc). The different functional regions of NCK2 are based on NCBI (NP_035009.3 ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB, Ipswich, MA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The mutants DSR2 (N133A) and DSR2 (H171A) were constructed using the Q5 Site-directed Mutagenesis kit (NEB, E0554S) using eaither primers JG216 and JG217 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by library preparation with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed as 100 bp single read sequencing on HiSeq2500™ (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... and domain-swapped chimeras were generated with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs). Single-end sequencing (75 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA transcripts were expressed using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Australia).
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Bioengineering 2019Quote: ... Japan) were inserted downstream of SaCas9 into the vector using a NEBuilder HiFi assembly kit (New England Biolabs). For construction of plasmid used for cell sorting ...
-
bioRxiv - Microbiology 2021Quote: ... Treated RNA was used for cDNA library preparation by NEBNext Ultra II RNA library kit for Illumina (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Microbiology 2019Quote: ... Table S2) were created by site-directed mutagenesis using the Q5 site-directed mutagenesis kit (New England BioLabs). For -10 region mutations ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis or promoter deletions were performed with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). PCR reactions were done in 50 μL containing 25 μL of Q5 Hot Start High-Fidelity 2X Master Mix ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA libraries were prepared by removing the ribosomal RNA with NEBNext rRNA depletion kit (New England Biolabs) and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA sequencing libraries were generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB England BioLabs). Fragmented and randomly primed 2 × 150□bp paired-end libraries were sequenced using Illumina HiSeq X10.
-
bioRxiv - Biophysics 2020Quote: ... Further truncation and point mutants of CreCat construct were prepared using the Q5 Site-Directed Mutagenesis Kit (NEB). Protein expression from E ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs) with following changes to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Biochemistry 2022Quote: ChIP-seq libraries were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Stranded cDNA libraries were generated using NEBNext Ultra Direction RNA Library Prep Kit for Illumina (New England Biolabs) and indexed with NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set I ...