Labshake search
Citations for New England Biolabs :
4951 - 5000 of 9425 citations for Mouse Plectin PLEC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... Barcoded libraries were made with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Libraries were pooled and sequenced (single-end 75 bp reads ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA libraries were generated using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, cat# E7103S) according to the manufacturer’s instructions with the following modification for bisulfite treatment ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries for sequencing were constructed using the NEB Next Ultra RNA Library Prep Kit for Illumina (NEB). The poly (A)-tailed mRNA was enriched using the NEB Next Poly (A ...
-
bioRxiv - Microbiology 2022Quote: ... sequencing libraries were generated using the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) with 1 μg of total RNAs ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA-Seq libraries were generated using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB # E7760L). Two biological replicates were sequenced using the Illumina NextSeq 550 platform to generate 150 bp PE reads ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesis was conducted via ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich MA, USA), using manufacturer’s instructions for reverse transcription of total RNA ...
-
bioRxiv - Systems Biology 2022Quote: ... The libraries were indexed with NEBNext Multiplex Oligos kit for Illumina (96 Index Primers, New England Biolabs, USA). Size distribution for the libraries and their quality were assessed using a high-sensitivity DNA chip (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extracted RNA from light and heavy fractions were subjected to qRT-PCR using Luna RT-qPCR kit (NEB).
-
bioRxiv - Plant Biology 2022Quote: ... ChIPseq libraries were prepared by NEBNEXT® UltraTM II DNA Library Prep Kit for Illumina (New England Biolabs) and sequenced using NovaSeq 6000 system (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... and a single band of the expected size was purified using Monarch Gel Extraction Kit (New England Biolabs). Purified amplicons from 6 Cas9-only control injected larva and from 24 gRNA-injected (and imaged ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and cloned into XbaI site of the pLS-mP-luc using NEBuilder HiFi DNA Assembly Cloning Kit (NEB). Fragments that failed to clone (human 2xHAR.11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... linearized plasmid by performing an in vitro transcription with SP6 using the Hiscribe SP6 RNA kit (#E2070S, NEB) and a cap analog from the ARCA kit (#S1411 ...
-
bioRxiv - Zoology 2023Quote: ... sequencing libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, Frankfurt, Germany) according to the manufacturer’s instructions without prior fragmentation ...
-
bioRxiv - Cancer Biology 2024Quote: ... and barcoded libraries were made using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB). Libraries were pooled and single-end sequenced (1×75 bp ...
-
bioRxiv - Neuroscience 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted using the Monarch® HMW DNA Extraction Kit (New England Biolabs, T3050S and T3060S) using manufacture’s protocol for iPSC samples ...
-
bioRxiv - Neuroscience 2022Quote: ... Complementary DNA (cDNA) was synthesized from 200ng RNA using LunaScript® RT-SuperMix kit (New England Biolabs #E3010). RT-qPCR reactions were performed using Luna® Universal qPCR Master Mix (New England Biolabs #M3003) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Y350A mutations of WW domains in Yki were generated by Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S) using pMT-yki-HA as a template ...
-
bioRxiv - Genomics 2022Quote: ... The purified product was then in vitro transcribed using “HiScribe T7 High yield RNA Synthesis Kit (NEB, E2040S) and purified using Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... histolytica RNA was prepared using the Monarch Total RNA Miniprep Kit (NEW ENGLAND BioLabs, Ornat, Nes Ziona, Israel). According to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) as described above ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNAseq libraries were prepared using the NEB Ultra II Directional RNA library Prep kit (New England Biolabs), with 1 ug total RNA input and initial poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 uL of Quick Ligation Buffer and 5 uL of Quick T4 Ligase (NEB Quick Ligation Kit, M2200S). The ligation reaction was incubated for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... viral cDNA was synthesized from the extracted RNA by using a LunarScript RT SuperMix Kit (New England BioLabs). The DNA was then amplified by performing a multiplexed PCR in two pools using the ARTIC-N5 primers and the Q5 Hot Start DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instruction and further purified using a Monarch® RNA Cleanup Kit (50 μg) (NEB). RNA integrity was monitored with agarose gels ...
-
bioRxiv - Microbiology 2022Quote: ... A sequencing library was generated using the NEB Next® Ultra™ DNA Library Prep Kit (NEB, USA) following the manufacturer’s recommendations and index codes were added to each sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... and further cleaning (to get rid of DNA contamination) with Monarch® Total RNA Miniprep Kit (NEB, T2010S) by following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Cell-free transcription and translation reactions were carried out using PURExpress® In Vitro Protein Synthesis Kit (NEB) following the manufactureŕs protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Ribosomal RNA was removed with NEB Ribo-Zero Plus rRNA Depletion Kit (New England Biolabs, Cat No. 20037135) prior to RNA-seq library preparation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total cDNA libraries were prepared using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB #E7765).
-
bioRxiv - Biochemistry 2023Quote: ... DNA synthesis was visualized by detecting biotin with the Phototope-Star detection kit (New England Biolabs Ref N7020S) and images acquired on a Chemidoc system (Biorad).
-
bioRxiv - Developmental Biology 2024Quote: ... Template pDNA was linearized and ARCA-capped IVT-mRNA was produced using the T7 HiScribe kit from NEB, pseudo-uridine was incorporated into the reaction ...
-
bioRxiv - Biochemistry 2024Quote: ... Mutants of PARIS were constructed from pFR85 using the Gibson method38 or Q5 site-directed mutagenesis kit (NEB). The PARIS triggers Ptr1 (T5 ORF094 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Sequencing libraries were generated using the NEBNext ® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: Extracted RNA was treated with DNaseI and purified using Monarch RNA Cleanup Kit (New England Biolabs, Massachusetts, USA). The cDNA was synthesised from approximately 1000 ng of RNA using ReverTra Ace qPCR RT Master Mix with gDNA remover (TOYOBO ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... total RNA was extracted using the Monarch® Total RNA Miniprep Kit (New England Biolabs, Ipswich, MA, USA). The extracted RNA was eluted in 50 μL of nuclease- free water and treated with Qiagen DNAse I (Germantown ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries for RNA-seq were prepared with NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) and sequenced on the NextSeq 500 platform (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... RNA-seq libraries were prepared using the NEBNext Ultra II Directional Library Prep Kit for Illumina (E7760, NEB). The size of the libraries was determined using a Bioanalyzer ...
-
bioRxiv - Genomics 2023Quote: ... Commercial and breeding program samples were extracted from frozen tissue using the Monarch Genomic DNA Purification Kit (NEB), as per manufacturer’ s instructions using the enzymatic cleanup protocol with both proteinase K and RNase A ...
-
bioRxiv - Biochemistry 2024Quote: ... at 37°C for 30 min and purified by Monarch RNA Cleanup Kit (New England Biolabs, Massachusetts, USA). The concentration of crRNA was determined by Nanodrop 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) and were sequenced on an Illumina NovaSeq 150bp paired-end platform ...
-
bioRxiv - Genetics 2024Quote: ... RNA-Seq libraries were prepared with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs). Capillary electrophoresis (Agilent Bioanalyser and Agilent Tapestation ...
-
bioRxiv - Microbiology 2024Quote: ... non incorporated primers were removed using the Monarch PCR and DNA clean up kit (New England Biolabs, T1030), using a binding buffer ratio to DNA of 3:1 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product of the selected deletion mutant was purified using Monarch PCR and DNA cleanup kit (NEB) and sent for sequencing at Eurofins Genomics LLC (Louisville ...
-
bioRxiv - Molecular Biology 2024Quote: ... the products were used to generate RNA transcripts using the HiScribe T7 In Vitro Transcription Kit (NEB, E2040S) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: Libraries were prepared using the NEBNext Ultra II FS Library Prep Kit (New England Biolabs, Ipswich, MA, USA), following the manufacturer’s instructions with inserts of approximately 350 bp ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA was then directly used in the Luna® Universal One-Step RT-qPCR Kit (New England BioLabs). Primers listed in supplemental table 10.