Labshake search
Citations for New England Biolabs :
4401 - 4450 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Libraries were prepared using the Next Single Cell / Low Input RNA Library Prep Kit (New England Biolabs). The quality and quantity of the final libraries were assessed with the TapeStation D5000 Assay (Agilent Technologies ...
-
bioRxiv - Neuroscience 2020Quote: Libraries were prepared using the Next Single Cell / Low Input RNA Library Prep Kit (New England Biolabs). The quality and quantity of the final libraries was assessed with the TapeStation D1000 Assay (Agilent Technologies ...
-
bioRxiv - Immunology 2020Quote: ... white colonies were picked and the plasmids were isolated using the Monarch® Plasmid Miniprep Kit (NEB). To verify that the picked colonies contain an insert of the correct size ...
-
bioRxiv - Microbiology 2021Quote: Prepared libraries were quantified using NEBNext® Library Quant Kit for Illumina® E7630L (New England BioLabs) and pooled with volumes adjusted to normalize concentrations and provide for ∼1,000-fold genomic coverage for population samples (20–30 samples per HiSeq lane depending on the genome size ...
-
bioRxiv - Neuroscience 2022Quote: ... MIT BioMicro Center prepared libraries using the NEBNext Ultra II RNA Library Prep Kit (New England Biolabs) and performed 75 bases single-end run NextSeq 500 Illumina sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and IFIH1 were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... amplified and size-selected using NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) and Agencourt AMPure XP (Beckman Coulter) ...
-
bioRxiv - Immunology 2022Quote: ... Single nucleotide mutations were introduced using site-directed mutagenesis (SDM) (New England BioLabs, NEB Base Changer kit). Once confirmed ...
-
bioRxiv - Genomics 2022Quote: ... crRNA was synthesized in vitro using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ChIP-seq libraries were prepared using the NEBNext Ultra™ II DNA Library Prep Kit (NEB E7103) with modifications ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid DNA from individual colonies was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, T1010L). All cDNA clones were verified by complete DNA sequencing of the ORF in both the 5’-3’ and 3’-5’ directions.
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were ligated using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA) and transformed into competent DH5a E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library prep was performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7103) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library prep was performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7103) and NEBNext Multiplex Oligos for Illumina (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The two PCR fragments were then assembled using the HiFi Gibson Assembly kit from NEB (Waltham, MA) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Metagenomic libraries were prepared with NEB Next Ultra DNA Library Prep Kit (New England Biolabs, ME, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Mutant (I32M and E48K) pDual_CLDN1 was created using Q5® site directed mutagenesis kit (New England Biolabs) with the following primers I32M_F (5’-CCA GTG GAG GAT GTA CTC CTA TGC C-3’) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmids from antibiotic-resistant clones were purified using a Monarch plasmid miniprep kit (New England Biolabs, USA) and subjected to whole plasmid sequencing (SNPsaurus ...
-
bioRxiv - Plant Biology 2020Quote: RNA-seq libraries were constructed with the NEBNext Ultra RNA Library Prep Kit of Illumina (NEB, E7530L), and were then sequenced on the Hiseq-Xten platform ...
-
bioRxiv - Cell Biology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Genetics 2020Quote: Barcoded libraries were prepared with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770) and the NEBNext rRNA Depletion Kit (NEB #E6310) ...
-
bioRxiv - Zoology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.25 μL of reverse transcriptase (M-MuLV Reverse Transcriptase kit from New England Biolabs, CAT# M0253S) was prepared and 3.25 μL of this master mix was added to each of the samples for a total volume of 20 μL ...
-
bioRxiv - Genetics 2020Quote: ... S154 and G184 using a Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs, Ipswich, MA, USA) to remove internal stop codons ...
-
bioRxiv - Immunology 2020Quote: ... ChIP-Seq libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB, #E7645) and sequenced by paired-end 75-bp sequencing kit on Illumina NextSeq550.
-
bioRxiv - Cell Biology 2020Quote: ... and reverse-transcribed to cDNA using a Protoscript II First Strand DNA Synthesis kit (New England Biolabs) using random hexamers as primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Library construction was done using the NEBNext Ultra™ II RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2020Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... GFP-MyoXΔPH and GFP-MyoXΔFERM were generated with Q5 Site-Directed Mutagenesis Kit (New England Biolabs, E0554S), where the amino acids (1212-1253 ...
-
bioRxiv - Cell Biology 2021Quote: ... Indexed sequencing libraries were generated using the NEBNext Ultra II DNA Library Prep kit (NEB Cat # E7645), pooled and sequenced on an Illumina HiSeq instrument as paired end reads (Novogene ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by strandspecific library prep with NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB E7760) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation was done with NEBNext Multiplex Small RNA Library prep kit for Illumina (New England Biolabs) according to the manufactures instructions except for downscaling all samples to half volume and using 30 ng of input RNA (100 ng recommended ...
-
bioRxiv - Systems Biology 2021Quote: ... The RNA library was prepared using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs) and sequenced on Illumina HiSeq 2 × 150 bp paired-end sequencing (GENEWIZ).
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared with a rRNA-depletion kit (E6310, New England Biolabs Japan, Tokyo, Japan) and a directional library synthesis kit (E6310 ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were generated using NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, USA) and sequenced on an Illumina Hiseq2500 platform (250 bp paired-end reads) ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer Y111E: 5’-TTGATGGAGACATTCTTC-3’) using the Q5 site-directed mutagenesis kit (E0554S, New England Biolabs) to generate a point mutant ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing libraries were prepared using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) including ERCC RNA Spike-in control ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and converted this mRNA to 280-300 bp cDNA fragments using the Ultra II Directional Kit (NEB). Unique sequencing adapters were added to each cDNA library for multiplexing (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs). These samples were sequenced on the high-throughput sequencing platform (HiSeq2500 ...
-
bioRxiv - Immunology 2021Quote: ... sequencing libraries were generated using the NEBNext UltraTM RNA Library Prep Kit for Illumina (New England Biolabs), and the library quality was assessed on the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA sequencing libraries were prepared with NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; E7645) according to the manufacturer’s instructions and quantified with KAPA Library Quantification Kit for Illumina (Kapa Biosystems) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reversely transcribed using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs #E7765S) as suggested by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... H3 and input) was processed with NEBNext Ultra II DNA Library Prep Kit (New England Biolabs #E7103S) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were generated using NEBNext Ultra II DNA Library Prep Kit for Illumina (E7103, New England Biolabs). The IDT Unique Dual Index adapters and universal primers used were [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC][AGATCGGAAGAGCGTCGTGTAGGGAAAGA GTGT] ...
-
bioRxiv - Microbiology 2021Quote: ... Site directed mutagenesis of plasmids were performed using Q5® Site-Directed Mutagenesis Kit (New England BioLabs) following manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... and site-specific mutations were introduced into DNA using the Q5 Site-Directed Mutagenesis Kit (NEB, USA) and custom-made primers ...