Labshake search
Citations for New England Biolabs :
4301 - 4350 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... media in each well was aspirated and cells were incubated in 80 μL of 1x Hanks’ balanced Salt Solution with 20 mM HEPES and 10 μL 100 μM Coelenterazine-400a diluted in PBS for 5 minutes before adding either 10 μL of 5.5 U of Enterokinase (New England Biolabs #P8070S) in PBS or 10 μL of vehicle PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were harvested and lysed as described above and were run over 5 ml of Amylose affinity resin (New England Biolabs), washed with 100 ml of 20 mM sodium phosphate pH 7.2 ...
-
bioRxiv - Cell Biology 2023Quote: MBP-tagged RH domain was isolated via passing cleared lysate over a gravity amylose resin column containing 5 mL of settled resin (NEB). Column was washed with 150 mL of buffer before eluting protein with wash buffer supplemented with 20 mM maltose ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and material was amplified for 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (New England Biolabs catalog # M0541L). After evaluation by real-time PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of 5’ adapter (10 µM) was added and incubated for 5 min at 65°C before addition of T4 ligase buffer (NEB), final 25% PEG8000 and T4 RNA ligase 1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of the library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Then ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation and dA-tailing by NEBNext FFPE DNA Repair and NEBNext Ultra II End prep modules (New England Biolabs) and purified with AMPure XP (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 μL of ligation reaction mix was prepared (1X ligation buffer, 5 units of T4 RNA ligase I (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of primers described in Supplementary Table 7 and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 µCi) ...
-
bioRxiv - Biochemistry 2024Quote: ... When relevant cmpRNA (500 pmol) was 5’-end phosphate-32 “hot” labeled using fresh gamma phosphate-32 labeled ATP (50 nmol) and PNK (NEB) following the producer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Microbiology 2024Quote: The 5’ end of the sigAb transcript was identified using 5’ RACE following manufacturer’s protocol with template switching RT enzyme mix (NEB; M0466). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... 1-5 mL of cell pellet was harvested for plasmid extraction with the Monarch Plasmid DNA Miniprep Kit (New England Biolabs) (T1010) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ and 5’ ends were modified accordingly and the respective adapters were ligated with a T4 RNA ligase I (New England Biolabs). The final products were size-selected one last time and rRNA depletion was performed using custom-made biotinylated oligos(38 ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro RNA transcription was performed in 50 µl reactions: 5 µl RNAPol Reaction Buffer (New England BioLabs, Ipswich, MA), 2 µl T7 RNA Polymerase (New England BioLabs ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Genomics 2021Quote: ... The selected DNA fragments were end-repaired and 3’-adenylated with the NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Cell Biology 2019Quote: ... We incubated our cells in complete medium containing 2 μM of SNAP-Cell TMR-Star (New England Biolabs) during 20 min to label all pre-existing available SNAP-tag (Pulse) ...
-
bioRxiv - Cell Biology 2020Quote: ... MNase (non-specific DNA digestion) used MNase buffer and 2 μL of enzyme (20 units/μL) PvuII (NEB), AluI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... 1 mM ATP and 10 mM DTT and with 1 μl (2 U/μl) of RNase H (NEB), 1 μl (3 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylated adapters (RRBS-1, RRBS-2; Table 1) were added by ligation using DNA ligase (New England Biolabs). DNA was purified using ratio of 1:1.2 sample to AMPure XP beads ...
-
bioRxiv - Genomics 2020Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Genomics 2019Quote: ... We treated 2 µg debranched DNA using the UltraII end repair/dA-tailing enzyme mix (New England Biolabs) followed by a purification using a 0.6 volume ratio of AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease, 0.2 µL of 10x NEB Buffer 4 and 1.6 µL of nuclease-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: 5μl of the first-strand reaction was mixed with 7.5μl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5μl water and amplified for three PCR cycles following the program ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 μL of NEB Buffer 2 and 15 μL of 25 U/μL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2019Quote: ... only the cells expressing iRFP-tau WT were treated with 2 U/μL λPP (New England Biolabs # P0753) for 3 hours at 30 °C with gentle rotating ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 µL of NEB Buffer 2 and 15 µL of 25 U/µL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...