Labshake search
Citations for New England Biolabs :
4101 - 4150 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and cDNAs were synthesized from 2 µg total RNA with Superscript II reverse transcriptase (New England Biolabs). RT-qPCR was performed in a StepOnePlus™ Real-Time PCR System (Applied BioSystems ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM CaCl2 and the indicated volumes of 2 units bovine pancreatic DNase I (New England Biolabs) were added for the indicated incubation times at 37 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL SUPERase•In RNase Inhibitor and 1 µL T4 RNA Ligase 2 truncated KQ (NEB, M0373L) were added to the RNA-adapter mixture ...
-
bioRxiv - Plant Biology 2021Quote: ... The cloning reaction consists of 25 cycles of 3 min at 37°C for digestion and 4 min at 16°C for ligation combining the restriction enzymes BsaI-HF (New England BioLabs, Ipswich, UK) for level 1 reaction or BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... by random priming without denaturation with 4 mg random nonamer oligo (Integrated DNA Technologies, Skoie IL) and 10 units of Klenow (New England Biolabs, Ipswich, MA). Unincorporated dye was removed with Microcon columns (30 kDa MW cutoff ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA ligase reaction buffer (New England Biolabs, NEB, Ipswich, Massachusetts, US), 0.5 μl dATP (10mM ...
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana IMPa-4 fragment were used for genomic PCR and followed by digestion with BamHI and XhoI (New England Biolabs, Ipswich, MA). The pTRV2 vector (ABRC ...
-
bioRxiv - Neuroscience 2022Quote: ... Supplementary Table 4) from each sample was further processed with the Illumina NEBNext Ultra II Directional RNA Library Prep Kit (NEB #E7760S/L) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... and the library was amplified 4 cycles by PCR using Phusion high-fidelity PCR master mix with HF buffer (New England Biolabs cat. #M0531L). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were incubated at 16 °C for 4 h in the presence of 1.15x of T4 ligation buffer (New England Biolabs, catalog no. B0202S) and 100U T4 ligase ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Biochemistry 2024Quote: ... Qiagen protocol 4 was followed for enzymatic lysis with lysozyme (DOT Scientific catalog #DSL38100) and 20 µL proteinase K (NEB catalog #P8107S). Qiagen protocol 7 was followed for RNA purification including DNase I digestion on-column (Qiagen catalog# 79254) ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA integrity was assessed by performing 1% TBE agarose gel electrophoresis with samples that had been boiled for 95°C for 5 min in RNA loading dye (New England Biolabs). Genomic DNA was eliminated by incubating 2 μg of RNA with 2 U of RQ1 RNase-free DNase I (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genetics 2021Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Molecular Biology 2022Quote: The L3 DNA linker at 0.5 μM concentration (Table S1) was ligated to RNA in a 20 μl reaction using 5 U/μl of RNA Ligase Truncated K227Q (NEB) in the presence of 15% PEG8000 and 1 U/μl RNasin (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Microbiology 2022Quote: ... The total RNA recovered was split into samples of 5 μg each and enriched in poly(A) transcripts using NEBNext Poly(A) mRNA magnetic isolation module (NEB) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 400-800 fmol of nucleosomes purified from sucrose gradients was digested with a 5-25U titration of ExoIII enzyme (New England Biolabs) for 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP sequencing libraries were built from immunoprecipitated DNA by first end repairing the DNA with 5 µL T4 DNA polymerase (NEB), 5 µL T4 PNK (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... CHART-enriched DNA was eluted twice in 200 μL elution buffer supplemented with 5 U/μL RNase H (New England BioLabs) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... aqueous phase containing the barcoded cDNA (~50 μL) was combined with 50 μL digestion mix containing 5 μL ExoI enzyme (NEB), 5 μL HinFI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: The splint ligation reaction was performed by preparing a 5 µl mastermix that consisted of 0.5 µL Hifi Taq Ligase (NEB #M0647S), 0.5 µl 10x Taq ligase buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR-amplified for 25 cycles with 5’-Cy3-labelled reverse primers (IDT) and unlabeled forward primers using either Taq polymerase or Phusion high-fidelity polymerase (NEB). PCR products were separated on 40cm tall 6% polyacrylamide denaturing gels and then visualized using a Molecular Dynamics Typhoon Scanner ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 50 ul of end fill-in mix (37 ul water, 5 ul 10X NEB Buffer 2 ...
-
bioRxiv - Genomics 2019Quote: ... RNA was resuspended and γ-ATP was added to the 5’ end of the RNA with T4 polynucleotide kinase (NEB) for 30min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The purified construct was then inserted at the 5’ end of the Fluc coding sequence with T4 DNA ligase (New England BioLabs). The resulting vector was termed Were-1-Fluc (Table 1).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 μg/well of purified BSA (NEB) in a volume of 50 μl ...
-
bioRxiv - Microbiology 2019Quote: ... 5’ UTR reporter constructs were assembled using NEBuilder® HiFi DNA Assembly Cloning Kit (#E5520S New England Biolabs Ipswich, MA). All amplifications were carried out following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2019Quote: ... the 11.4 kb fragments of GPV- or HIV- GPP were joined with their cognate 304 bp zip coded partial U3 inserts via Gibson Assembly in a molar ratio of 1:5 per reaction using HiFi DNA assembly mix (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: Different CpG-containing oligonucleotides with 5’-TTAA overhangs were annealed and end-to-end ligated overnight at 16°C with T4 ligase (NEB). Oligos were ethanol-precipitated and filled-in with 1 mM biotinylated dUTP (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed for 5 hours at 42 °C using 100 U of ProtoScript® II Reverse Transcriptase (NEB), 10 U of RNase Inhibitor (Murine ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...
-
bioRxiv - Cancer Biology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 µg/well of purified BSA (NEB) in a volume of 50 µl ...
-
bioRxiv - Genomics 2019Quote: ... solution was diluted 1:20 and 5 μL used in a standard 50 μL PCR reaction using Q5 enzyme (NEB). PCR products were Sanger sequenced and analyzed using SnapGene to identify SNP corrected clones (7/192) ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Molecular Biology 2019Quote: A 1 kb long DNA fragment with biotin molecules attached to the 5′ termini (dibiotin-DNA) was generated by PCR amplification using Q5 High-Fidelity Polymerase (NEB), with pAM075 as a template and the 5′-biotinylated primer pair oAM091/oAM092 ...
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Genetics 2020Quote: ... was incubated with or without 5 µM nucleotides DNA substrates (cssDNA, Phi X174; or ldsDNA, Phi 174 RF I; both from NEB) with 1 mM ATP in ATPase buffer (25 mM Tris-HCl [pH 7.5] ...