Labshake search
Citations for New England Biolabs :
4451 - 4500 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... chromatin was digested overnight at 37°C with the addition of 25 μL 10X NEBuffer2 and 100U (5 μL) of HindIII (NEB, R0104S), followed by 20 min incubation at 62°C to inactivate the HindIII ...
-
bioRxiv - Cell Biology 2020Quote: A synthetic miR-409-5p oligo was 5’ end-labelled with γ-P32 ATP using T4 polynucleotide kinase (New England Biolabs) and purified using G-50 columns ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 µl of this DNA mixture and 2.5 µl of UltraPure water was added to 5 µl of NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621) on ice ...
-
bioRxiv - Genomics 2019Quote: To prepare the RNA sample for use in a smallRNA library preparation kit the sample was phosphorylated using 5 ul of 10X T4 PNK buffer and 1 ul of T4 PNK (NEB #M0201), 1 ul of SUPERASE-In ...
-
bioRxiv - Developmental Biology 2022Quote: ... The regulatory sequences of Crbn were PCR amplified from genomic DNA (primers in Supp Table 5) and cloned into a pCESA vector upstream of H2BGFP coding sequences using the restriction enzymes AscI and NotI (NEB England). Mutations into the Snail binding motif of the Crbn regulatory sequences were obtained by recombination using NEBuilder (NEB England ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 pmol dephosphorylated RNA was 5’ phosphorylated with 32P from γ-32P ATP (Hartmann Analytic) with T4 PNK (New England Biolabs) in 1x PNK buffer in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Toe-printing reactions were carried out in 5-µl aliquots containing a PURExpress transcription-translation coupled system (New England Biolabs, USA) to which the test template was added (16) ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... ds-DNA was constructed from two oligos that are annealed and 5’ overhangs filled in using Klenow polymerase according the manufacture’s specifications (NEB cat. M0210L). All yeast transformation were carried out using the lithiumacetate method ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by treatment with DNase I.5 The samples were then purified with the Monarch® RNA Cleanup Kit (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was carried out by addition of 5 µL 10 µM Nextera index mix(Vazyme, #TD203) and 25 µL Q5 High-Fidelity 2X master mix (NEB, #M0492S) to the 20 µL sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Genomics 2022Quote: ... 1500 calcein-stained cells in 5 μL of were added to 35 μL of barcoded hydrogel templates with 29 U/mL Proteinase K (NEB #P8107S) and 70 mM DTT (Sigma #D9779 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 13 nt long RNA was radiolabelled at the 5’-end with [γ-32P] ATP and T4 Polynucleotide kinase (New England Biolabs) prior to complexes assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... A 13 nt RNA oligonucleotide was radiolabeled at the 5’ end with [γ-32P] ATP and T4 polynucleotide kinase (New England Biolabs) prior to EC assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Immunology 2024Quote: ... Insert and vector were combined at a 5:1 ratio and held at 50 °C for 1 hour in NEBuilder® HiFi DNA Assembly Master Mix (NEB). Gibson assembly products were purified using the MinElute® PCR Purification Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The tube containing the plugs was then cooled to 42°C before adding 5 µl of Beta-Agarase I (New England Biolabs, M0392) and incubating at 42°C for 1 hour ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Plant Biology 2023Quote: ... 7 µg (DNA mass) of NCPs (with 188bp NPS) or free DNA was incubated with 5 Kunitz units of MNase (NEB M0247) in a reaction buffer (30 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... NGS sequencing libraries were prepared from 1 µg of genomic DNA spiked with known ‘spike-in’ controls by introducing Illumina adaptors and 5-bp-long index sequences using Q5® High-Fidelity 2X Master Mix (NEB). The barcode amplification was verified in parallel polymerase chain reaction (PCR ...
-
bioRxiv - Genomics 2023Quote: ... samples were split into 5 μg aliquots for sequencing library preparation using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, E7645L) and NEBNext Multiplex Oligos (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... oligonucleotide X12-3 HJ3 (93 nt) was labeled at the 5’ terminus with [γ-32P] (Hartmann-Analytic) and T4 polynucleotide kinase (New England Biolabs), according to standard protocols65 ...
-
bioRxiv - Neuroscience 2023Quote: ... The mRNA was fragmented using divalent cations under 94°C for 5-7min using the NEBNextTM Magnesium RNA Fragmentation Module (New England Biolabs, #E6150S). RNA fragments were reverse-transcribed using SuperScriptTM II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid CassetteAv2_pBAD contains the CRISPR03 array cloned into the pBAD/Myc–His B backbone (Life Technologies).12 It was used to prepare CRISPR DNA substrates by PCR with primers MMB1Lead40-5 and MMB1crisp3-r1 using Phusion High-Fidelity DNA polymerase according to the manufacturer’s protocol (New England Biolabs or ThermoFisher). The resulting 88-bp PCR product has a 40-bp leader ...
-
bioRxiv - Molecular Biology 2023Quote: ... The fragmented RNA was then subjected to a 5’ dephosphorylation reaction at 37°C for 30min by adding rSAP (NEB, M0371L) and PNK enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Initial PCR amplifications were carried out in a 30 μl mixture that included 5 μl of KAPA HiFi Fidelity Buffer (New England Biolabs, UK), 0.3 μM of forward and reverse primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Double-stranded oligonucleotides corresponding to synthetic enhancers with gibson arms were synthesized by IDT (GeneBlock) and assembled into targeting vector using 5 μl of NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S), 36 ng of linearized vector ...
-
bioRxiv - Biochemistry 2023Quote: ... The total RNA was treated by DNase I (5 U per 100 μg total RNA) and mRNAs were enriched by NEBNext Poly(A) mRNA magnetic isolation module (NEB E7490L). 8-10 μg of mRNA from each sample was fragmented to the size of ~120-nt by Ambion Fragmentation reagent (Thermo Scientific AM8740 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and sequencing libraries were prepared from 5 ng of the purified amplicon using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, E7370L) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...
-
bioRxiv - Genomics 2023Quote: ... Multiplex-polymerase chain reaction (PCR) was performed in two separate reaction mixes prepared by combining 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), 0.5 μl of 10 mM dNTPs (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... was modified with a guide RNA (GTCGGACGCGAAACTCGCTT) to target the 5’ region of the ROP33 gene (sgROP33) using Q5 mutagenesis (New England Biolabs, MA). Then a CRISPR/Cas9 replacement construct was created using Gibson assembly (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The 5’ termini of all ten DNA fragments (F1-F9 and the linker) were phosphorylated by using T4 PNK (NEB; #M0201), and the equimolar amounts (0.05 pmol each ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Systems Biology 2024Quote: ... The resulting full-length cDNA was gel-purified and ligated to the 5′ adaptor OWG920 with High Concentration T4 RNA Ligase (NEB M0437M) overnight on a shaking thermomixer ...
-
bioRxiv - Systems Biology 2024Quote: ... 3 µl of 100 µM barcode-linked oligo-dT primer was added to each well with 5 µl of 5x ProtoScript RT buffer (New England Biolabs M0368). The plate was incubated at 94°C for 2 min and immediately cooled on ice for at least 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transposed DNA was then purified on Diapure columns (Diagenode, Transposed purified DNA was then pre-amplified for 5 PCR Cycles using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were constructed using the NEBNext Ultra II directional RNA library preparation kit for Illumina according to the protocol for purified mRNA or ribosome-depleted RNA and with a 5-min RNA fragmentation step (NEB E7760). Library PCRs were supplemented with 2× SYBR dye (Sigma S9430 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Prior to library preparation a UDG-treatment was performed using 16.25ul of purified DNA and 5 μl (1U/1uL) USER enzyme (New England BioLabs®, Inc.) and an incubation of 3 hours at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... A 691 bp biotinylated DNA handle with a 29 nt 5′ overhang was amplified by Q5 DNA polymerase (NEB, Cat# M0491S) using a 5′ biotinylated forward primer and a reverse primer containing an abasic site 43 ...
-
bioRxiv - Immunology 2024Quote: ... we performed an A-tailing of the PCR products of the YTS191-light chain cDNA by adding 5 µl of 10X ThermoPol Buffer (NEB, B9004), 10 µl of 10 mM ATP ...