Labshake search
Citations for New England Biolabs :
4401 - 4450 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Plant Biology 2024Quote: ... Genes of interest were cloned to Gateway™ pENTR™ 4 Dual Selection Vector (A10465) by NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621L) and cloned to a pUC19 expression vector powered by the maize ubiquitin promoter (ZmUBI ...
-
bioRxiv - Neuroscience 2024Quote: ... Pellets were resuspended in NEB buffer prior to centrifugation at 11,500 rpm for 20 minutes at 4°C on a sucrose gradient (1.6M sucrose in NEB and 0.8M sucrose in NEB). Nuclei-containing pellets were fixed with 0.3% formaldehyde in NEB and rotated at room temperature for 10 minutes ...
-
bioRxiv - Genomics 2020Quote: ... Biotin was removed at 20°C for 4 hours in a 50 μL reaction for every 5 μg of DNA using 15 units of T4 DNA polymerase (NEB, M0203L) and 25 nM dATP and 25nM dGTP in NEBuffer 3.1 (no dTTP and dCTP) ...
-
bioRxiv - Genetics 2021Quote: ... Plasmid was isolated from the remainder of the original 5-mL culture of the R599A culture using standard methods and digested with PvuI-HF (New England Biolabs #R3151) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’-ACGTACGCGGCCGCAAAATGAGGCTGCACCTGGCGGCGATCC-3’ and 5’-ACGTACTCTAGACTACTCGTGCCACTCGATCTTCTGGGCTTCAAATATGTCATTCA AACCGCCTCCAATTACAAAGGCCGTGATCCAGTCCAGAAACTTGGCC were employed in a high-fidelity PCR reaction (Q5® High Fidelity DNA Polymerase, New England Biolabs) using a plasmid bearing a Drosophila gd cDNA as template ...
-
bioRxiv - Genetics 2021Quote: ... Custom inverse complementary adapters that had inverse complementary terminal modifications to ensure unidirectional ligation (3’-T overhang and 5’ phosphorylation) were ligated onto both ends of the respective subsets using the Ultra II Ligation Module (NEB, USA) according to manufacturer’s instructions and purified with 1:1 bead cleanup (Figure 3) ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Genomics 2021Quote: ... Amplification reactions from this cDNA were performed with the 5’ PCR primer and a reverse primer corresponding to the target sequence using LongAmp Taq polymerase (NEB M0287). The PCR products were sequenced and the junction between the ligated oligo revealed the start sites.
-
bioRxiv - Synthetic Biology 2021Quote: SynHox assemblon BACs were verified by digesting a ∼250-500ng purified by alkaline lysis (72) from small scale (5-10 mL) saturated bacterial culture with PvuI-HF (New England Biolabs R3150S). Digestion reactions were carried out at 37°C for 3-24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... the 5’-homology arm was amplified from y,sc,v genomic DNA using Q5 High-Fidelity DNA Polymerase (New England BioLabs, NEB) with primers ...
-
bioRxiv - Genomics 2021Quote: ... Purified DNA was subjected to an initial step of PCR amplification consisting of 5 cycles using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S) and standard barcoded primers of Nextera kit for each sample ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... PCR work was carried out with primers provided by IDT (Integrated DNA Technologies) (Table 5) and with a proof-reading Q5® High-Fidelity DNA Polymerase (New England Biolabs) according to the manufacture’s guidelines ...
-
bioRxiv - Plant Biology 2021Quote: ... The pooled PCR reactions were purified with the Monarch® PCR & DNA Cleanup Kit (5 μg) (New England Biolabs® Inc.) and run on 6% acrylamide gel ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labeled DNA fragments captured on beads were ligated to multiplexing adaptors by adding 5 μL each adapter (50 μM) and 1 μL T7 DNA ligase (NEB, M0318L) in 100 μL ligation mixture and incubating at room temperature for 1 hour with rotation ...
-
bioRxiv - Immunology 2022Quote: ... The plates were subsequently fixed using 5% formaldehyde and immuno-stained using a monoclonal anti-SARS-CoV-NP antibody (Creative-Biolabs; NP1C7C7). In brief ...
-
bioRxiv - Microbiology 2022Quote: ... The V4 region of the 16S rRNA gene was amplified from approximately 5 ng of extracted DNA in 25μl reactions using Q5 HS High-Fidelity polymerase (New England BioLabs, Ipswich, MA) with inline bare primer design as previously described.51 The following V4-specific primers were used ...
-
bioRxiv - Biochemistry 2022Quote: ... the used RNA was radioactively labelled on the 5’-end with [γ-32P]ATP (10 mCi/ml, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... The samples were run in a 5% native PAGE gel in an ice bath along with low range ssRNA ladder (New England Biolabs, Inc.). The gels were prepared using Acrylamide ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired oligos (sgRNA-F and sgRNA-R; see Table S8) with 5′ overhangs were first treated with T4 polynucleotide kinase (NEB, M0201), then cooled from 95°C to 4°C at a 0.1°C/sec ramp rate ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were purified with the oligonu-cleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit (5 μg) user manual (NEB #T1030). Purified PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Biophysics 2021Quote: ... to obtain a 1080 bp long DNA with 5 bp overhang and was subsequently dephosphorylated with Antarctic phosphatase (NEB, catalog #M0289S). The obtained product was PCR purified using Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2022Quote: pGEMHE plasmid constructs (Supplementary Table 2A) were linearized and 5’-capped mRNA was synthesized with T7 polymerase (NEB HiScribeT7 ARCA kit) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... All but 5 µl of this product was then diluted 20x into a PCR reaction that consisted of 1x Taq buffer (NEB, B9014), 1 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... The RNA bound to Gag was first dephosphorylated at the 5’ end with calf intestinal alkaline phosphatase (New England BioLabs, NEB) followed by T4 polynucleotide kinase-catalyzed (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: DNA oligonucleotides 308 and 310 were 5’-radiolabeled with [γ-32P] ATP (Perkin-Elmer) using T4-polynucleotide kinase (New England Biolabs). Radiolabeled nucleotides were then purified by electrophoresis in a 12% native polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products (donor-5’biotin, donor-unmodified) were gel purified using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) and eluted in 20μl embryo transfer water (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Colony PCRs were carried out in 12.0 μL final volumes containing: 5 μL of high-fidelity OneTaq® QuickLoad® 2X Master Mix (New England Biolabs), appropriate forward and reverse control primers (both 0.4 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis of the 5-HT2C construct was performed according to the Q5® site-Directed Mutagenesis Kit protocol (New England BioLabs). In brief ...
-
bioRxiv - Cell Biology 2019Quote: ... were performed with 5-10 μM final protein concentration and 10 μM dye (SNAP-Surface Alexa Fluor488 (New England Biolabs S9129S) or SNAP-Surface Alexa Fluor647 (New England Biolabs S9136S) ...
-
bioRxiv - Cell Biology 2019Quote: 40pmol of single stranded oligonucleotide was labelled at the free 5’-OH group with 20 units of T4 polynucleotide kinase (NEB # M0201) in a 50 μl reaction volume containing 1X polynucleotide kinase buffer and 30 μCi γ32P ATP at 37°C for 30min ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... The Nested PCR product (5 μl) was digested with NciI restriction enzyme at 37°C for 15 min (New England Biolabs, USA). The final digested DNA fragments was resolved in 2.5 % gel electrophoresis stained with ethidium bromide and visualized with Bio-Rad gel doc XR (Molecular Imager ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... were heated to 65°C and slow-cooled to 37°C before reverse transcription with 5 U AMV-RT (NEB, M0277L) at 42°C for 1 hour ...