Labshake search
Citations for New England Biolabs :
3651 - 3700 of 3709 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 0.5 – 1 μg DNA template were in vitro transcribed using HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA), following manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... 1 μg of RNA was used to generate sequencing libraries using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following polyA selection ...
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB, Cat. No. / ID: E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and single colonies were picked 1 day later to grow up and extract plasmid DNA using a Monarch Plasmid Miniprep Kit (New England Biolabs, Cat. No. T1010L). Extracted plasmid DNA was sequence confirmed via long-read Nanopore sequencing (Primordium Labs ...
-
bioRxiv - Genomics 2023Quote: ... The cDNA libraries were constructed from 1 ug input RNA using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB), following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cell Biology 2022Quote: ... 15 μL of cell lysate was further treated for 1 h at 37°C with 40 units of Quick calf intestinal alkaline phosphatase (CIP, New England Biolabs, Ipswich, MA, USA) per the manufacturer’s recommendations ...
-
HTLV-1 Splice Sites in Prevalent Gene Vectors Cause Splicing Perturbations in Transgenic Human CellsbioRxiv - Genomics 2023Quote: ... Following magnetic bead purification one third of the cDNA per sample was subjected to PCR amplifications with the primers HTLV-1 and PE-2nd-GA using the NEBNext® Ultra™ II Q5® Master Mix (NEB) using the cycling program ...
-
bioRxiv - Genomics 2023Quote: ... We purified and enriched mRNA from 1 ug of total RNA using the NEBNext Poly(A) Magnetic Isolation Module (New England Biolabs, catalog no. E7490L). RNA fragmentation ...
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 5 μL of a sense oligo and then added 40 μL of phosphorylation reaction mix containing 1 μL of T4 Polynucleotide Kinase (PNK; NEB, cat. no. M0201S), 5 μL of T4 PNK buffer (NEB ...
-
bioRxiv - Bioengineering 2023Quote: ... The DNA fragments encoding enriched peptide genes were mixed with sfGFP gene portion and assembled by 1 hour incubation at 50°C using HiFi Master mix (NEB Japan, Tokyo, Japan). The reaction mixture was then used in PCR amplification with primers 13 and 14 to obtain peptide-sfGFP gene fragments suitable for cell-free protein synthesis ...
-
bioRxiv - Molecular Biology 2023Quote: 1 µg of total RNA was used to perform mRNA isolation using NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB Cat. No. E7490). The resulting mRNA material was used to prepare the libraries with the use of NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Adaptor ligation was performed with 1:25 diluted adaptor and 15 cycles were used for library amplification using dual indices (NEB dual index kit). Paired-end 2×25 bp sequencing was performed on a NextSeq500 Illumina Sequencer.
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Genomics 2023Quote: ... We then ligated barcodes to the end-prepped DNA using the Native Barcoding Expansion 1–12 kit (EXP-NBD104, Oxford Nanopore Technologies, Oxford, UK) and Blunt/TA Ligase Master Mix (New England Biolabs, Ipswich, MA, USA). We cleaned the barcoded samples using 0.9X AMPure XP beads ...
-
bioRxiv - Genomics 2023Quote: ... using the Adapter Mix II from the Native Barcoding Expansion 1–12 kit and NEBNext Quick Ligation Reaction Buffer (New England Biolabs, Ipswich, MA, USA) as well as Quick T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... each containing 50 ng of DNA (comprising both vector and insert at a 1:3 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was incubated at 16°C overnight and column-purified with molecular biology-grade water ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no. N0552S; New England BioLabs, Ipswich, MA) and ran at 105 V for 45 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... F: agaagtcttagcatatgtggtac R: aacagatgttggacccttcc RNA diluted at 1/100 was amplified using Luna® Universal One-Step RT-qPCR Kit (NEB, Ipswich, MA) according to the manufacturer’s directions on a QuantStudio3 (Applied Biosystems ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of the supernatant was used as template for PCR using the Q5® High-Fidelity 2X Master Mix (NEB, Cat. # M0492L) and the primer pair prCP222-prCP223 to amplify FCY1 (Table S2) ...
-
bioRxiv - Systems Biology 2024Quote: ... 50 µL reverse-crosslinking buffer (3.33 µL 0.5M EDTA, 1 µL 10% SDS, 2 µL Proteinase K NEB #P8111S, 43.67 µL EB buffer) was added to each sample ...
-
bioRxiv - Plant Biology 2024Quote: ... to create a level-1 plasmid by cut and ligate reaction using BsaI restriction enzyme and T4 DNA ligase from NEB (New England Biosciences). All plasmids were confirmed by restriction digestion and DNA sequencing ...
-
bioRxiv - Biophysics 2024Quote: ... cells were incubated for 2 hours in a dye solution containing 1 µM SNAP-tag ligand BG-AF647 (New England Biolabs, catalog no. S9136S), 1 mM dithiothreitol (neoFroxx ...
-
bioRxiv - Cell Biology 2024Quote: ... was used to do the library according to the manufacturer protocol with the following index set NEBNext Multiplex Oligos for Illumina (Dual-Index Primers Set 1; NEB, cat. no. E7600S) and sequenced on AVT system.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Library preparation for sRNA from sperm samples was done using the New England BioLabs kit NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 (NEB #E7300 and NEB #E7580). The provided guidelines of NEB were followed for small sample preparation until step 15 ...
-
bioRxiv - Biochemistry 2022Quote: For crystallization the Ioc4 PWWP domain (aa 1-178; Ioc4PWWP) was cloned into a modified pMAL-c2X vector (New England Biolabs, Liu et al., 2001) in order to produce a fusion protein with an N-terminal maltose-binding protein (MBP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μL annealed stem-loop oligonucleotide was mixed with 1 μL pre-linearized vector and ligated with T4 DNA ligase (cat. no. M0202, New England BioLabs, Inc., Ipswich, MA, USA), according to vendor’s ligation protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and annealed (denaturation at 95°C for 5 min and then slow cooling of the samples at the rate of -2°C/sec from 95°C to 85°C and then - 0.1°C/sec from 85°C to 25°C for annealing of heteroduplexes) before addition of T7 Endonuclease I (NEB, Ipswich, Massachusetts, USA, M0302S). Heteroduplexes containing small mutations at the intended site should be cleaved into two fragments ...
-
bioRxiv - Biochemistry 2021Quote: ... according to the LAMP method described earlier with additions to the earlier described CRISPR Mix (Modification: 1 μL NTP Buffer Mix (From NEB #E2050, no additional MgCl).
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were prepared from 1 μg of total RNA using NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) by poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: ... The gene fragment was amplified from approximately 30ng of DNA in each sample (primers in Supplementary Table 1) using a high-fidelity polymerase (NEB Q5, New England Biolabs)[27] and confirmed by 1% agarose gel electrophoresis ...
-
bioRxiv - Bioengineering 2022Quote: ... Processing the samples for proteomics was then continued using a 10 kDa filter aided sample preparation protocol previously published with minor modifications.[30] The proteins were digested using Lys-C enzyme (P8109S, New England Biolabs, MA, USA; 1:50) and then with trypsin (V5111 ...
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Genomics 2022Quote: ... and the presence or absence of one of two RNAse inhibitors (1 – Millipore Sigma, Protector RNAse Inhibitor, Cat. No. 3335399001; 2 – NEB, RNAse Inhibitor, M0314S). The RNA was then extracted from the tissue using the miRNeasy kit (Qiagen Cat ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... leprae positive faecal and necropsy samples (Supplementary Information Table 1) were converted into dual-indexed libraries using the NEBNext® Ultra™ II DNA Library Prep kit (New England Biolabs, MA, USA)57,58 ...
-
bioRxiv - Genomics 2020Quote: PCR products were loaded into a single lane on a 1% agarose gel with 100 bp DNA ladder (New England Biolabs, Frankfurt am Main, Germany). Fragments between 200 and 500 bp were cut from the gel with a scalpel and purified using the QIAquick gel extraction kit (QIAgen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reversely transcribed into cDNA from 1 μg of mRNA template using the M-MuLV cDNA Synthesis Kit (New England Biolabs, Frankfurt am Main, Germany) according to the protocol of the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... The precipitates and one-fifth of the supernatant were boiled in SDS loading buffer and subjected to western blot analysis using an anti-MBP monoclonal antibody (New England Biolabs, E8032S, 1:200 dilution), followed by anti-mouse IgG-HRP (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequencing libraries were generated from 1 μg RNA per sample using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequencing libraries were generated from 1 µg total RNA per sample using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... gDNA was extracted using full B2M locus primers (Supplement Table 1) and amplified with Q5® Hot Start 2x Master Mix (New England Biolabs, Ipswich, Massachusetts, US). The target DNA was purified by PureLink® PCR cleanup (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sequencing libraries were prepared following Chapter 1 of the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England BioLabs, NEB) protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® and the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, New England Biolabs, Ipswich, Massachusetts, USA) and following the manufacturer protocol ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was subjected to end-repair in the same reaction by adding 1 μl of Klenow fragment (New England Biolabs cat. M0210S, 5000 U/ml) and 1 μl of dNTP mix (10 mM dA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were washed once with PBS for 3 minutes and subjected to nuclear staining with Hoechst (New England BioLabs; 4082S; diluted 1:5000 in PBS) for 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein amounts of OP18 and beta-actin were quantified using a primary stathmin polyclonal antibody (1:1000; Cell Signaling Technology, NEB GmbH, Frankfurt/Main, Germany) and a polyclonal beta-actin antibody (1:1000 ...