Labshake search
Citations for New England Biolabs :
3501 - 3550 of 3709 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Single turnover reactions were carried out as follows: 5 µM Clr4 was preincubated 5 minutes with 1 mM final S-adenosyl-methionine (liquid SAM, 3 2mM, NEB #B9003S), and varying concentrations of pSwi6 or unP Swi6 ...
-
bioRxiv - Biochemistry 2024Quote: ... was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB, M0264L) for ssDNA digestion at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic region (∼2000 bp) surrounding the natural start codon on exon 1 was cloned into the pUC19 vector (New England Biolabs, N3041S) by Gibson Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4x106 JM8+/+ and Bmal1-/- cells were fixed with formaldehyde 1% and digested overnight at 37°C using 400U of MboI (New England Biolabs, #R0147M). After filling with 50nM biotin-dATP (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 25 μg was then diluted to 100 μL with CP-1 buffer with or without 2 μg/mL proteinase K (New England Biolabs P8107S) and the indicated concentration of digitonin or 2% Triton ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assembly reaction was performed at 1:2 vector: insert ratio using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs #E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: ... We mixed the digested handles with the large 38 kb fragment in 10:1 molar ratio (biotin-handles to DNAparS) and added T4 DNA ligase (New England Biolabs, M0202L) and 1 mM ATP for ligation ...
-
bioRxiv - Genomics 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Genomics 2024Quote: ... and 1.0 µL T4 DNA Ligase (100 units/µL, NEB M0202L buffer diluted 1:3 in NEB B8001S enzyme dilution buffer) were added to each reaction ...
-
bioRxiv - Genomics 2024Quote: ... approximately 1 μg of total RNA underwent rRNA depletion using the NEBNext rRNA Depletion Kit (NEB, Ipswich, MA, USA, Cat# E6318). RNA-seq libraries were then prepared following the whole transcriptome sequencing protocol of Novogene (https://www.novogene.com/us-en/resources/blog/a-basic-guide-to-rna-sequencing/) ...
-
bioRxiv - Biochemistry 2024Quote: ... the DNA digestion or cleavage activity of the proteins was performed by incubating 50 nM protein with 10 ng ml -1 pUC19 plasmid (NEB N3041S), in a 20 µl reaction at 37 °C for varying time conditions in 20 mM Hepes pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... This modified vector was digested at 37ºC for 1 hour and purified with Monarch® DNA Gel Extraction Kit (NEB #T1020).
-
bioRxiv - Biophysics 2024Quote: ... the linearized backbone and insert were mixed in a 1:2 molar ratio and ligated using Gibson assembly (NEB, Cat. # E5510S) at 50°C for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... A 1 kb DNA ladder (New England Bio Labs #N3232S) was mixed with Gel Loading Dye Purple 6X (New England Biolabs #B7024S) and water ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were diluted at a 1:5 ratio with H2O prior to qPCR using Luna Universal qPCR Master Mix (New England Biolabs, #M3003) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of RNA was converted to cDNA using the ProtoScript® II First Strand cDNA Synthesis Kit (New England BioLabs), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA synthesis was performed from 1 µg total RNA using the ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs, NEB) with the provided random primer mix according to the suppliers’ instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was generated from 1 μg of total RNA using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, #E6560).
-
bioRxiv - Molecular Biology 2020Quote: ... 13.5 μl digestion reaction product was combined with 1.5 μl second-strand synthesis (SSS) buffer and 1 μl of SSS enzyme mix from the NEBNext mRNA Second Strand Synthesis Module (NEB, Cat #E6111) and incubated at 16 °C for 2.5 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Biochemistry 2020Quote: ... NEB protocol #M0276 with incubation extended to 1 hour) and a Cap 0 analog (using a Vaccinia capping system, NEB protocol #M2080), following the recommended procedures ...
-
bioRxiv - Molecular Biology 2020Quote: Targeted sequencing for specific off-target or on-target sites was performed via a standard 2-step PCR using gene-specific primers with adaptors in the first round of PCR amplification and NEBNext® Multiplex Oligos for Illumina® (Dual Index Primers Set 1) (New England Biolabs) for the second round of PCR amplification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...
-
bioRxiv - Genomics 2021Quote: ... 1 µg of genomic DNA was digested in a 40 µl volume of 1x CutSmart buffer with 1 µl of MFRE (MspJI or FspEI; New England Biolabs, Ipswich, MA) and 1.4 µl activator oligonucleotide (15 µM stock ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Twenty-four PCR reactions (24 x 50 μl) were performed with 1 U of Q5 high-fidelity polymerase (New England Biolabs®, M0491), 200 μM dNTPs ...
-
bioRxiv - Plant Biology 2021Quote: ... #ltp1.4ltp1.8-1 and #ltp1.4ltp1.8-2) were chosen for constructing next generation sequencing libraries following the manufacture’s protocol (NEB Next Ultra II DNA kit). Sequencing was carried out using 2 × 150 paired-end NextSeq500 (1-2 Mio reads for all samples together ...
-
bioRxiv - Biochemistry 2021Quote: ... for 2 hr at 60 °C and relinearized at the basic dSpacer furan with Ape 1 (15 U; M0282S, NEB, Ipswich, MA) for 2 hr at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genes of interest were cloned into the pLenti CMVTRE3G eGFP Neo (w821-1) plasmid using a Gibson Assembly Master Mix kit (Cat# E2611S, New England Biolabs, Ipswich, MA). pLenti CMV rtTA3 Blast (w756-1 ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 ∼ 1.5 μl of DNA extract was added to 20 μl of PCR reaction mix containing standard PCR buffer and 1 unit of Taq DNA polymerase (Cat # = M0273, New England Biolabs, Beverly, MA). For long-range PCR ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were prepared using 1 µg of RNA and the NEBNext Ultra™ II RNA Library Prep Kit (NEB, E7775) with rRNA depletion following the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... purified Trx-FER-KD and FER-KDK565R proteins were treated with 1 μl of λ-phosphatase (λ-PP) (400,000 units/ml, New England Biolabs. P0753S) and 1 mM MnCl2 for 1-2 h at room temperature ...
-
bioRxiv - Genetics 2022Quote: ... the truncated versions of cwr-1 and the histidine mutant plasmids were prepared using the Q5 Site-Directed Mutagenesis Kit (E0552S NEB, Ipswich, MA). Gibson assembly (E2611S NEB ...
-
bioRxiv - Microbiology 2020Quote: ... samples were washed in phosphate buffered saline (PBS) and labelled with 1:500 of 10mg/mL Hoechst 33342 (New England Biolabs, Cat# 4082S) for 10 min with a subsequent wash in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Triplicate NEBuilder HiFi assembly reactions were prepared according to manufacturer’s protocols containing ∼2:1 insert to vector as follows: 10 µl of 2X NEBuilder HiFi master mix (New England Biolabs, cat#E2621S), 158.7 ng of DNA fragments ...
-
bioRxiv - Immunology 2021Quote: ... The linearized vector and the synthesized fragment in a 1:2 molar ratio were assembled with the NEBuilder HiFi DNA Assembly Kit (NEB, Ipswich, USA) at 50°C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of total RNA was used as template for complementary DNA synthesis using MuLV reverse transcriptase (New England Biolabs, Cat. M0253L) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Cancer Biology 2020Quote: ... 6ul eluted RNA was used for Small RNA libraries using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Small RNA libraries were prepared from the extracted 1ug total RNA or 100ng PIWIL1-antibody-pulled down RNA using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) (NEB, Cat# E7300S) according to the manufacture’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 3 μl from 100 μl of enzymatically converted and 1 μl from 15 μl of bisulfite-converted DNA were PCR amplified with Q5U polymerase (NEB, Ipswich, MA) and primers (Supplemental Table 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...