Labshake search
Citations for New England Biolabs :
3251 - 3300 of 3709 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Genomics 2024Quote: ... The recovered DNA was end-repaired and ligated to Illumina indexed adapters using the NEBNext Ultra DNA Library Prep Kit for Illumina NEB) and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1: NEB). The adapter-ligated DNA underwent 6 or 8 cycles of PCR amplification ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and Dnase I (1 U/ml, New England Biolabs). Cells were washed and 5-9 x 106 PBMCs were then seeded/well in a 24-well plate in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was diluted 1:10 and used for qPCR reactions employing Luna® Universal qPCR Master Mix (New England Biolabs). Ct values were computed by the instrument and used for calculation of ΔΔCt using ACTB (Beta-actin ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells or islets were incubated for 24 hours post-transfection / transduction before labelling with 1 µM SNAP-Surface fluorescent probes (New England Biolabs) for 15-20 minutes for cells ...
-
bioRxiv - Pathology 2024Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and Set 2) (NEB, E7335S and E7500S). Paired end sequencing was performed (S1 and S2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of genomic DNA (∼100 ng) was mixed with 8 µl of 1x Cutsmart buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Amplicons were analyzed by 1% agarose gel electrophoresis and purified according to the sizes using the DNA Gel Extraction Kit (NEB).
-
bioRxiv - Genetics 2024Quote: ... IVS5-IVS6) was amplified from genomic DNA isolated from Patient 1 using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with 35 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT ...
-
bioRxiv - Microbiology 2024Quote: ... All three libraries were rescued post-transformation by inoculation into 1 ml of SOC outgrowth medium (New England Biolabs, B9020S) pre-warmed to 37°C and incubated with aeration at 37°C for 1 hour.
-
bioRxiv - Molecular Biology 2024Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 µL of both the strands at a concentration of 100 µM was added to 1 µL of T4 PNK (New England Biolabs), 1 µL of T4 ligation buffer and 6 µL of H2O ...
-
bioRxiv - Synthetic Biology 2024Quote: Plasmid DNA was pre-digested with the Not I enzyme in a reaction containing 1 μL of CutSmart buffer (NEB), 0.5 μL of NotI-HF enzyme (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... Annealed oligos are diluted 1:20 with DNase free water and 1uL is used in a Hi-T4 (NEB, M2622S) ligation reaction at room temperature for 1 hour ...
-
bioRxiv - Synthetic Biology 2024Quote: Golden Gate cloning reactions were performed using forty fmol of plasmid parts in a reaction mix recipe of 1 µl restriction enzyme (BsmBI-v2, Esp3I, or BsaI-HF-v2) (New England Biolabs), 1.5 µl bovine serum albumin ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Laboratory vectors and plasmid constructs (Supplementary Table 1) were purified using the Monarch Plasmid Miniprep Kit (New England Biolabs, UK). DNA fragments for cloning were amplified using Q5 DNA polymerase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified HIV-1C T/F LTR PCR products were cloned into the linearized C731CC lentiviral vector by ligation using 1 U of T4 DNA ligase (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting RNA’s purity was assessed by NanoDrop and run on a 1% agarose 1X TBE gel using 2X RNA Loading Dye (New England Biolabs) and stained with 1µg/mL ethidium bromide ...
-
bioRxiv - Biophysics 2024Quote: ... We combined the plasmid backbone with the colony PCR insert by mixing them in molar ratio 1:3 in the 2xHiFi mix (New England Biolabs) to obtain the final plasmid of 4175 bp ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µg of DNA origami nanoparticle was mixed with 1 U/µl DNase I (2,000 units/mL, New England Biolabs, M0303S) mixed with 10× DNase I buffer diluted in water (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: Nucleoside-modified mRNAs were produced from 1 μg of linearized template DNA using the HiScribe T7 mRNA Kit with CleanCap Reagent (New England Biolabs) according to manufacturer instructions with the following modifications ...
-
bioRxiv - Plant Biology 2024Quote: ... Annealing was performed with 1 µl of annealed sgRNA and 100 ng of linearized vector using T4 DNA Ligase (New England BioLabs). The ligation product was transformed in E ...
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Biochemistry 2024Quote: ... an aliquot of the dense DNA fraction of the second gradient was desalted and subsequently digested for 1 h at 37°C with single-strand-specific nuclease P1 and RNAseH (both New England Biolabs). Digestion-resistant DNA was purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... The NNK ultramers and the replication oligo pool were extended in a 1-cycle PCR (Q5 high-fidelity DNA polymerase, NEB) with primers TSO_2 and TSO_65 (Supplementary Data File 5) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10X T4 Ligase Buffer and 1 µL of NEB Golden Gate Assembly Kit (NEB, catalog no. E1602L) with 65 cycles of digestion at 42°C and ligation at 16°C for 5 min each ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Genomics 2024Quote: ... 2 µl of the 1:10 diluted adapter-ligated library aliquot were amplified in 10-µl reactions containing 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEB_mws20 primer (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T (IDT) ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pre-amplified for 14 cycles against a pool of primers (Extended Data Table 1) using PreAmp Grandmaster mix (TATAA Biocenter) before exonuclease I treatment (NEB). Pre-amplified cDNA was diluted at least five-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad ...
-
bioRxiv - Genomics 2024Quote: ... Δ([fimB or yjiT]-opgB)114::IS10 Δ(dcm::FRT1)1) and the dcm+ (DHB4, GenBank accession: CP014270.1) genomic DNA were obtained from NEB. The m4C containing genomic DNA from Natrinema pallidum BOL6-1 archaea was also obtained from NEB.
-
The ATP-dependent protease ClpYQ degrades cell division proteins DivIVA and Mbl in Bacillus subtilisbioRxiv - Biochemistry 2024Quote: ... Reaction mixtures were prepared with a 25 μL final volume and contained 1 X Φ29 DNA polymerase reaction buffer (NEB), 0.1 mg/mL recombinant albumin (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... The HT-PAMDA substrate libraries containing the four control plasmids (combined at a ratio a 1:100 control plasmid pool to HT-PAMDA library) were linearized with PvuI-HF (NEB) before performing HT-PAMDA previously described18,37.
-
bioRxiv - Biochemistry 2024Quote: Transgene template RNAs and mRNAs for cellular transfection were made using 1 ug of plamid fully linearized with BbsI (NEB) for 4 h at 37 °C and purified with PCR purification kit (QIAGEN ...
-
Single-molecule analysis reveals the mechanism of chromatin ubiquitylation by variant PRC1 complexesbioRxiv - Biophysics 2024Quote: ... a 5-10 fold excess of the annealed and labeled chromatin anchor was added to 130 µg of BsaI-digested chromatin DNA in 400 µl of 1× T4 ligation buffer along with 50 units of T4 ligase (NEB) per 1ug of chromatin DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 µL of reaction mixture containing 1 µg of template was prepared for in vitro transcription using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... A plasmid expressing HIV-1 Gag with an internal EGFP tag was generated using the NEB HiFi Assembly Kit (New England Biolabs). A lentiviral backbone containing a tetracycline-inducible promoter and a gene encoding rtTA was prepared by digesting the pCW57.1 plasmid (Addgene #41393 ...
-
bioRxiv - Bioengineering 2024Quote: ... cleanup was performed before dA tailing using Taq polymerase (34 μL eluate, 1 μL 10 mM dNTP mix (NEB, N0447S), 1 μL Taq polymerase (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL of linearised backbone and 1 µL digested pMB.BIG1a-e mix were used to set up a 20 µL Gibson Assembly (NEB #E2611) reaction ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA pellet was resuspended in 50 μL of TE buffer and 1 μL was used in qPCR reaction with Luna qPCR Master Mix (New England Biolabs).
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was then diluted 1:4 to a total volume of 20 μL and 1 μL was used as template for qPCR with the Luna qPCR Master Mix (New England Biolabs) in a total reaction volume of 10 μL ...