Labshake search
Citations for New England Biolabs :
3501 - 3550 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μL Proteinase K (New England Biolabs P8107S) (final concentration of 0.2 mg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... 4 µL 10 mM ATP (NEB, Cat #P0756S), 40U (2 µL ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL 10X rCutSmart buffer (NEB, B6004S) incubated at 72°C for 5 min) ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Genomics 2021Quote: ... exonuclease I (Exol) treatment was performed on all samples by adding 4 ul ExoI buffer and 4 ul ExoI (New England Biolabs, M0293L). Samples were incubated at 37 C for 30 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µL 32mM S-Adenosyl methionine (NEB) (final concentration 0.8 mM) ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 Us of exo(-) Klenow Fragment (NEB), 200 pmol of NNSR-2 Primer for 30 min at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 5 μl Large (Klenow) fragment (NEB) to the DNA at R.T ...
-
bioRxiv - Immunology 2022Quote: ... containing 5 U murine RNase Inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of restriction enzyme BsaJI (NEB) was directly mixed with 300ng of DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5× Q5 High GC Enhancer (NEB). PCR thermocycling conditions were 98 °C during 5 s ...
-
bioRxiv - Microbiology 2022Quote: ... m7G(5’)G RNA Cap Analog (NEB) or Anti-Reverse Cap Analogue (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Genetics 2021Quote: ... and 5 μl Murine RNase Inhibitor (NEB). Worm lysate was cleared by centrifugation at 20,000 × g for 20 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... To supernatant 5 μl 10x CutSmart (NEB) was added and incubated with 20 units ExoI nuclease (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 polynucleotide kinase (NEB), and 25 μL of DEPC H2O and incubating at 25 °C for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of T4 DNA polymerase (NEB), 1 μL of Klenow DNA polymerase (NEB) ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl 10X CutSmart buffer (NEB B7204S) and 0.5 µl BbsI or BsaI_HFv2 (the enzyme used for the cloning reaction) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 5 mM sodium orthovanadate (New England Biolabs), and 10 mM sodium fluoride (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl of Gibson assembly mastermix (NEB) and dH2O up to 10 µl were mixed and incubated at 50°C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... and Antarctic phosphatase (5 U/μl, NEB) in a ratio of 1:10:20 ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 5 µl T4 DNA ligase (both NEB) and 5 µl FastDigest Eco31I (BsaI isoschizomer from ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used as a cloning strain ...
-
bioRxiv - Biophysics 2023Quote: ... coli 5-alpha cells (New England BioLabs). Following mutagenesis for fluorescent labeling and/or creating RTT mutations using the Q5 mutagenesis kit (New England BioLabs) ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) was used for construction and propagation of plasmids ...
-
bioRxiv - Biophysics 2023Quote: ... 5 units of restriction enzyme EcoRI (NEB) were added to the nucleosome array in the absence and presence of DBDC/EBP⍺ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (New England Biolabs) and LB Miller medium (Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 5 U AMV-RT (NEB, M0277S) and gene-specific reverse primers ...
-
bioRxiv - Biochemistry 2023Quote: Escherichia coli (NEB 5-alpha, NEB C2987H) were grown in 5 ml LB broth at 37°C and shaking at 180 rpm until the culture reached OD600 0.7 ...
-
bioRxiv - Neuroscience 2022Quote: ... NEB 5-alpha cells (New England Biolabs) were transformed with pAAV constructs and the integrity of inverted terminal repeats and expression-related elements in selected clones were confirmed by sequencing and restriction digests ...
-
bioRxiv - Genomics 2024Quote: ... and 5 units of EPAP (NEB, M0276L). The reaction was incubated at 37°C for 5 min ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart buffer 10x (NEB), 5 μl of ATP 10 mM, ...
-
bioRxiv - Genomics 2024Quote: ... and 5′ hydroxyl repair with PNK (NEB). The 5′ adapter was ligated with T4 RNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... coli NEB® 5-alpha cells (NEB). Transformed cells were plated on LB agar containing spectinomycin (0.1 g L-1 ...