Labshake search
Citations for New England Biolabs :
3651 - 3700 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... with 5 μl T4 Ligase Buffer (NEB, B0202), 400 units T4 Ligase (NEB ...
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... 5 µl of NEB3 buffer (New England Biolabs) and 10.75 µl of DNase-free water (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 µl of 10X NEB2 buffer (NEB, US), and 35 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... NEB 5-alpha F’Iq cells (New England Biolabs) were used as the recipient strain for all plasmid constructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of CKII kinase (New England Biolabs) and 2.5 μL λ phosphatase (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with RNA 5’ Pyrophosphohydrolase (NEB) according to the manufacturer’s instructions prior to RNA circularization ...
-
bioRxiv - Immunology 2021Quote: ... and RNAs were 5’dephosporylation by quickCIP (NEB). Input (sRNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 U of Taq Polymerase (NEB, M0267) and incubating the samples at 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 μL final reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µL terminal transferase (TdT) (NEB, CN M0315L). The reaction was incubated at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... and 5’ end repair with T4 PNK (NEB). The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 μl 5× Q5 Polymerase Buffer (NEB #M0491), 0.25 μl Q5 DNA Polymerase (NEB #M0491 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Excess adapters were digested using 5’-Deadenylase (NEB) and RecJf (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the 5-µl of Bst 2.0 (NEB, M0537S) enzyme mixture (1× isothermal buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5′ cap repair with RppH (NEB) and 5′ hydroxyl repair with PNK (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 U/μL Taq DNA polymerase (NEB) for incubation at 25°C for 60 min and heating at 68°C for 30 s and then at 75°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 20 μM Cas9 (New England BioLabs), and 5 μL of 40 μM transcribed dgRNAs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Escherichia coli NEB 5-a (New England Biolabs) was used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... Escherichia coli NEB- 5-alpha (New England Biolabs) was used for cloning and BL21(DE3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 U of Antarctic phosphatase (NEB M0289S) then incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μl of quick ligase (NEB M2200L). To release the non-ligated strand of the adaptor ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Physiology 2024Quote: ... 5 μL of PNGaseF (500 U/μL, NEB) with 1x GlycoBuffer 2 (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: RNase H 5 U/µL (NEB, Cat#M0297S)
-
bioRxiv - Developmental Biology 2024Quote: ... and NEB 5-alpha Competent E.coli (NEB C2987H) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 µL of O-Glycosidase (P0733L, NEB) where indicated prior to denaturation/loading on SDS-PAGE gels according to manufacturer protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U/μl exonuclease III (NEB M0206L) and incubating for 15 min at 37°C with agitation (800 rpm 10 s ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli NEB 5-alpha cells (New England Biolabs). Part plasmids and the pET21b(+ ...
-
bioRxiv - Genomics 2024Quote: ... 40 U Antarctic Phosphatase (5 U/µL, NEB), 100 pg [15N5]8oxodG (Cambridge Isotope Laboratories ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 units/μl T3 RNA polymerase (NEB, M0378S) and 1 x RNAPol reaction buffer (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL TAQ Ligase (NEB, 40 U/µL) and 0.5 µL BST DNA Polymerase FL (NEB ...
-
bioRxiv - Genomics 2024Quote: ... including 5-methyl-dCTP (NEB, Catalog no. N0356S), 5-Carboxy-dCTP (TriLink ...
-
bioRxiv - Biophysics 2024Quote: ... and further nicked with 5 units Nb.BbvCI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2024Quote: ... together with 5 units DNA Pol I (NEB). The mix was incubated for 1 hour at ∼22 °C and cleaned using magnetic beads ...
-
bioRxiv - Biophysics 2024Quote: ... T5 exonuclease (5 units/μg DNA, NEB, M0363) was added to the mixture and incubated at 37 °C for 30 min to digest the remaining nicked DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... coli poly(A) polymerase (5 U/μL) (NEB), with incubation at 37°C for 2 minutes ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB® 5-alpha Competent E. coli), and successful genetic manipulation was confirmed with sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... After addition of 200 µl nuclease elution mix (NEB nuclease P1 buffer 1 x, MgCl2 5 mM, 0.5 µl NEB nuclease P1, 0.5 µg benzonase) samples were incubated over night at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Systems Biology 2021Quote: ... PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6) for 5 cycles at an annealing temperature of 66C followed by 5 cycles with no annealing step (NEB Q5) and then purified with the Monarch PCR kit.
-
bioRxiv - Systems Biology 2021Quote: ... P1 indexing barcodes were added using forward primers P1_inner_A through P1_inner_D and reverse primer P1_inner_nested_rev (Supplementary file 6) for 5 cycles at an annealing temperature of 55C followed by 5 cycles with no annealing step (NEB Q5). PE2 indexing barcodes were then added by amplifying 2 microliters of the previous reaction with forward primer P1_outer and reverse primers PE2_outer_SIC69 and PE2_outer_SIC70 (Supplementary file 6 ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...