Labshake search
Citations for New England Biolabs :
3351 - 3400 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the RNA was ligated to the 5’ adapter from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adapter-ligated RNA was reverse-transcribed using SuperScript II (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysates were incubated with 0.9 mM MnCl2 and 7 U/μl lysate lambda protein phosphatase (λPP; New England BioLabs), or 0.9 mM MnCl2 and H2O as control ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Taq I-digested chromatin was diluted 7-fold to which 10,000 cohesive end units of Quick T4 DNA ligase (New England Biolabs) were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were generated by 7 rounds of PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2023Quote: ... asynchronous or mitotic HeLa cell lysates were incubated with 0.9 mM MnCl2 and 7 U/µl λPP (New England Biolabs) or 0.9 mM MnCl2 and water for 1 h at 30 °C.
-
bioRxiv - Genomics 2024Quote: ... 30 µL of the eluted DNA samples were mixed with 7 µL of TSO digestion mix (3.5 µL UDG-DNA glycosylase and 3.5 µL UDG Buffer, NEB M0280S) and incubated at 37 ºC for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Immunology 2024Quote: ... A set of 217 442 7-mer sequences from a previously published analysis (Matochko et al., 2014; Matochko and Derda, 2013) of the same PDL (Ph.D -7, New England Biolabs) without prior selection was used as a background non-selected library to bootstrap the frequency of idiotopes among mimotopes ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 units of Taq polymerase (NEB), and 5 pmoles each of the following primers ...
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-phosphorylated with T4 PNK (NEB) and annealed oligonucleotides were used for UP-homology (oBA1761/oBA1762 or oBA1765/oBA1766) ...
-
bioRxiv - Neuroscience 2022Quote: ... Subsequent 5’ dephosphorylation by quickCIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... NEB 5-alpha (New England Biolabs), or XL-10 Gold (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... 5× Phusion HF buffer (NEB, USA), a dNTP nucleotide mix containing 200 μM of each nucleotide (Promega) ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... 5 U lambda exonuclease (NEB M0262S), and 20 U E ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 U of T4 PNK (NEB) were included in the initial NsiI digestion reaction and incubated at 37 °C for one hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl ExoI buffer (NEB, B0293S), 5 μl CutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl CutSmart buffer (NEB, B7204S), and 30 μl nuclease-free water and incubated for 1 hour at 37 °C and 10 minutes at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNase H (5 U, NEB, M0297S) was added followed by incubation at 37 °C for 20 min and 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/ml DNase I (NEB), 1x PhosStop phosphatase inhibitor cocktail (Roche) ...
-
bioRxiv - Immunology 2020Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... and Adenosine 5’-Triphosphate (ATP) (NEB). After RNA recovery using an RNA MinElute Cleanup Kit (QIAGEN) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB, R3733L), 250 U T4-ligase and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...