Labshake search
Citations for New England Biolabs :
3701 - 3750 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.4 mM phenylmethylsulfonyl fluoride (PMSF) and 4 µM pepstatin) and digested with the chosen endoglycosidase (PNGase F, New England Biolabs; or Endoglycosidase H, Roche) in a small volume of the appropriate buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... allowing a minimum RNA integrity number (RIN) of 7 (Schroeder et al., 2006) before fragmentation using NEBNext® Magnesium RNA Fragmentation Module (NEB, Ipswich, MA) into short fragments using divalent cations under high temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Biophysics 2021Quote: ... 4 µL of 0.2 mg/mL of streptavidin (NEB; N7021S) in crystallization buffer were added to the biotinylated lipid surface and incubated for 30 min in a humidity chamber at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... β1-4 galatosidase or α2-3,6,8 Neuraminidase (New England BioLabs) at concentration of 5000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μl of T4 DNA ligase (40U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 4 μl 10× T4 RNA ligase buffer (New England Biolabs), 4 μl T4 RNA ligase ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 μl LunaScript RT SuperMix (5X) (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 µl of 3U/µl NEB T4 DNA polymerase (NEB), and 1 µl of 5U/µl NEB DNA polymerase I ...
-
bioRxiv - Plant Biology 2021Quote: ... The 4 fragments were fused together using NEB builder (NEB). The reaction was amplified by PCR for 30 cycles and transformed into B ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of thermolabile proteinase K (New England Biolabs, P811S) added to Mitochondria-bound beads resuspended in 30 µl of KPBS ...
-
bioRxiv - Biophysics 2023Quote: ... “no SDS” loading dye (New England Biolabs, UK; 4 µL) was added to each sample (15 µL ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Immunology 2023Quote: ... and 4 by using the high-fidelity Phusion (NEB Biolabs) 3-step PCR protocol ...
-
bioRxiv - Systems Biology 2023Quote: ... and SpeI-HF (New England Biolabs, Ipswitch, MA;, and 4) the barcode fragment digested with BstEII-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
Analysis of natural structures and chemical mapping data reveals local stability compensation in RNAbioRxiv - Biophysics 2024Quote: ... 4 μL of T7 RNA polymerase (New England Biolabs #M0251S), and 33 μL RNase-Free water ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We treated the crRNA with 4 U DNase I (NEB) to remove any remaining DNA templates for 15 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 μL of 10X T4 DNA ligase buffer (NEB). The thermocycling protocol was 30 cycles of 5 min digestion at 37°C and 5 min ligation at 16°C ...
-
bioRxiv - Genomics 2020Quote: ... Further processing for mRNA selection was performed with Oligo-d(T)25 Magnetic Beads (NEB, E7490) and the integrity of the RNA was validated once more with Agilent 4200 TapeStation (Agilent ...
-
bioRxiv - Genomics 2021Quote: ... the rest was subjected to pull-down with oligo-d(T)x25 magnetics beads (NEB-S1419S), 1ml of slurry per 1L of cell culture during 1 hour at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... polyadenylated RNA was isolated from total RNA using oligo d(T)25 Magnetic Beads (NEB, #S1419S) at a 1μg Total RNA to 10μg beads ratio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the D-AlaR cassette (pGGF003) were combined in a ’Greengate reaction’ using BsaI-HF (NEB), T4 DNA-Ligase (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was generated from Venus BBa_J176006 with primers 5’-tctgcacctgaggccaccatggtgagcaagggcgagg and 5’-ggtcacgaattccagcaggaccatgtgatcg via high fidelity PCR followed by spin-column purification (NEB #E0555, Sigma #NA1020). The YFP fragment and mutated pSBtet-GP plasmid were double-digested with Eco81I/ EcoRI (Thermo #FD0374 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... 5 mM CaCl2) with MNase (#M0247S, New England Biolabs). The obtained digest (mononucleosomes ...
-
bioRxiv - Microbiology 2020Quote: ... at the 5’ end and NotI (New England Biolabs) at the 3’ end ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added with 5 μl CutSmart Buffer (NEB, B7204) and digested for 2 hours at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), and water to bring to 25 μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli strains: NEB 5-alpha (NEB C2987, not authenticated), BL21-AI (ThermoFisher C607003 ...