Labshake search
Citations for New England Biolabs :
301 - 350 of 1875 citations for Potassium Bromate 90 95% Chemical Purity 18O3 98% 100 Ug Ml In 18O Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The pellet was resuspended in 15 µl distilled water and mixed with 10 µl Gel Loading dye 6X (New England BioLabs). The samples were migrated in an 8.5% SDS-polyacrylamide gel at 180 Volts for 120 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the reaction was purified with the Monarch RNA Cleanup Kit (500 micrograms) with elution in 50 µl nuclease-free water (NEB). The quality of the gRNA prep was confirmed by agarose gel electrophoresis and quantified using a NanoDrop One (Thermo Fisher).
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was diluted 1:1 with nuclease-free water and used in Q5® High-Fidelity DNA Polymerase (NEB) reactions (as recommended by the manufacturer ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genetics 2020Quote: The annealed sgRNA oligos were diluted 1:200 in water and ligated into the pX459 plasmid that has been linearized with restriction enzyme BbsI (New England Biolabs). The ligation mixture contained 2 ul of diluted sgRNA oligos ...
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... 4.5 μg of RCA material was diluted in 65 μL of nuclease-free water and treated with 2 μL of T7 endonuclease I (New England Biolabs) for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was eluted in 17μl of water and further 3’ A-tailed using 2.5 units of Klenow 3’ to 5’ exo(-) (NEB, cat M0212) in 1X NEB buffer 2 supplemented with 0.2 mM dATP for 30 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: 10 μg of >200nt RNA (in nuclease-free water) was decapped using 200 U yDcpS and yDcpS buffer (NEB, #M0463S) at 37°C in a thermomixer at 800rpm pulse shaking ...
-
bioRxiv - Microbiology 2023Quote: ... The eluted gp120 coree protein was deglycosylated overnight in a 37 °C water bath with Endoglycosidase Hf (New England Biolabs). Afterwards ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... The products were purified using the Zymo Research kit and eluted with 6 uL water and 1 uL was electroporated into DH10B cells (NEB). Electroporated cells were recovered in 975 uL of LB and plated on LB agar containing carbenicillin (100 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: The commercially synthesized oligo pool was diluted 1:10 in water and amplified using the Phusion HotStart Flex polymerase (NEB) according to the manufacturer’s protocol with the Array_F and Array_R primers (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Air-dried pellet was then dissolved in nuclease free water for further processing and 1μg of total RNA was used for cDNA conversion using AMV Reverse Transcriptase (NEB, USA) in a 20μl reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... eluted in 20 µl of water and PCR amplified using 25Lμl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541LL), 2.5Lμl of each i5 and i7 Illumina index adapter (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... adding nuclease-free water to a final volume of 1 L) with 1:1000 (vol/vol) proteinase K (New England Biolabs) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2022Quote: Purified modified RNA and RNA without any chemical modification were digested with the Nucleoside digestion mix (M0649, New England Biolabs) at 37°C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... Chemical fragmentation of ligated RNA to ≤200nt was performed using the Magnesium RNA fragmentation kit (New England Biolabs, cat#E6150S). 2ul RNA Fragmentation Buffer was added and samples were incubated at 94°C for 5 minutes followed by a transfer to ice and the addition of 2μl of RNA Stop solution ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 μg/ml ScFv16 and 25 mU/ml apyrase (NEB). The solubilisation was incubated stirring at 4 °C for 2 hours before insoluble material was removed by centrifugation at 30,000g for 30 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 μg/ml NB35 and 25 mU/ml apyrase (NEB). The solubilisation was incubated stirring at °C for 2 hours before insoluble material was removed by centrifugation at 30,000g for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 50 µg of BSM or 5% v/v washed erythrocytes in PBS were treated with 1:100 NA VLPs or 1:100 Arthrobacter ureafaciens NA (NeuA, New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme (NEB)) and incubated at 37°C for 3 hours with constant shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were labelled with 100 nM Halo-TMR ligand and 100 nM SNAP-Cell 647-SiR ligand (New England Biolabs) for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: 100 μl 2x LAMP master mix (NEB, E1700L),
-
bioRxiv - Genetics 2021Quote: ... in 100 μl system with CutSmart Buffer (NEB), 37°C overnight without shaking ...
-
bioRxiv - Bioengineering 2020Quote: LbCas12a (final concentration 100 nM, New England Biolabs) was incubated with 1x NEB Buffer™ 2.1 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μg of streptavidin magnetic beads (NEB, S1420S) were pre-blocked with glycogen ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 U of DpnII restriction enzyme (NEB, R0543) was added and chromatins were digested at 37°C for overnight ...
-
bioRxiv - Microbiology 2021Quote: ... or 100 nM TMR substrate for SNAPtag (NEB) for 30 minutes at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.6 µL of 100% DMSO (NEB #12611P), with the following thermal cycle condition ...
-
bioRxiv - Microbiology 2023Quote: ... A 100 pb DNA ladder (New England Biolabs) was used as the molecular weight marker in these gels.
-
bioRxiv - Synthetic Biology 2023Quote: ... into 100 µL 10-beta electrocompetent cells (NEB), and then plated on 10 15 cm LBSpect agar plates for 16-20 h (37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 or 500 units of recombinant CK2 (NEB), 5µM or 15µM silmitaserib (CK2 inhibitor ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 0.6 µL of 100% DMSO (NEB #12611P), with the following thermal cycle condition ...
-
bioRxiv - Bioengineering 2024Quote: ... Approximately 100 μL of Proteinase K (NEB P8107S) digestion solution was added to each gel-containing well and incubated for ∼6 hours at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... we first dried the sample in a universal vacuum system (Savant UVS 400) and then resuspended in RNase-free water and digested the RNA into nucleotides by Nucleoside Digestion Mix (NEB, M0649S) in 15 μl volume and used 10 μl for the test ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and eluted in 10 μL of Ultra Pure™ DNase/RNase free distilled water: the purified amplicon and the 1kb DNA ladder (NEB) were run on 1% agarose gel in 1x TBE for 1 h 30 min at 110 V ...
-
bioRxiv - Microbiology 2019Quote: Bacterial 16S rRNA genes were amplified from 50 ng DNA per sample diluted to 10 µL nuclease free water in 50 µL with 1 × LongAmp Taq master mix (New England Biolabs, Inc), 1 µL 16S rRNA gene barcoded primer (ONT-SQK-RAB-201 ...
-
bioRxiv - Genetics 2020Quote: ... We then eluted the DNA from the beads using 10 μl of water and added to it 25 μl NEBNext HiFi 2x PCR MasterMix (NEB M0541), with 2.5 uL of each of the dual-indexed Illumina Nextera primers (25 μM) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 µl of this DNA mixture and 2.5 µl of UltraPure water was added to 5 µl of NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621) on ice ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was diluted 1:25 in water and used as template for RT-qPCR using the Luna Universal qPCR master mix (NEB M3003S). Primers used are listed in Supplementary Table 3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and eluted in 10 μL of Ultra Pure™ DNase/RNase free distilled water: the purified amplicon and the low molecular weight DNA ladder (NEB) were run on 2% agarose gel in 1x TBE for 1 h 40 min at 100 V ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Purified DNA was eluted in 30 μl of Ultrapure water and 10ng was inputted into the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S) using the following PCR programme ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of 100 ng/µLcDNA diluted from the previous step was combined with 2 µL of block mix and 2 µL of nuclease free water (NEB, AM9937), and then the cDNA block oligo mix was incubated on a thermocycler under the following conditions to allow block oligo mix to bind to the 5′ end and the 3′ end of the cDNA molecule ...
-
bioRxiv - Microbiology 2023Quote: ... The pellet was resuspended in 20 µl of distilled water and mixed with 18 µl gel loading dye (New England Biolabs, Inc.). Samples were resolved in a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Genetics 2023Quote: ... Samples were then incubated in 30°C water bath for 5 hours with 50 μL of RCA mixture that contained 250 μM dNTP (New England Biolabs, N0447L), 1 mM extra-supplemented DTT ...