Labshake search
Citations for New England Biolabs :
251 - 300 of 1875 citations for Potassium Bromate 90 95% Chemical Purity 18O3 98% 100 Ug Ml In 18O Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Five-hundred ng RNA in 9μl nuclease-free water was mixed with 3μl NEBNext Quick Ligation Reaction Buffer (New England BioLabs), 0.5μl RNA CS (ONT Kit) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock, New England Biolabs), and 1 µl of each enzyme used as described in Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Free nucleotides were purchased as 100mM stocks of dATP or dUTP as sodium salts in ultrapure water (NEB) and stored at -20°C ...
-
bioRxiv - Genetics 2024Quote: ... then resuspended and incubated in 20uL digestion buffer (1.1mL 1M Tris-HCl of pH6.8 in 50mL deionized water) with 2uL proteinase K (New England Biolabs) at 37°C for 15min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pelleted RNA was resuspended in 20 µL nuclease-free water and treated with DNase I (New England BioLabs) for 10 minutes at 37°C in the presence of RNasin Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 units T4 DNA ligase (NEB), and 1X T4 DNA ligase buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 units T4 DNA ligase (NEB), and 1X T4 DNA ligase buffer (NEB) ...
-
bioRxiv - Biophysics 2020Quote: ... 100 U E.coli RNAP (M0551S, NEB), 200 pM probe DNA ...
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per smgRNA.
-
bioRxiv - Bioengineering 2022Quote: ... 100 μg.μL-1 BSA (NEB, B9000S) to a final volume of 10 μL per condition.
-
bioRxiv - Cell Biology 2023Quote: ... and 100 U Exonuclease I (NEB) for 2 hours at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 units lambda phosphatase (NEB, P0753S), and/or phosphatase inhibitor cocktail (2x final concentration ...
-
bioRxiv - Genetics 2023Quote: ... 0.5 μL Cas12a (100 μM) (NEB) and 0.2 μl of 10X NEB 2.1 buffer were mixed gently in a PCR tube and incubated at 25°C for 15 minutes in a Thermal Cycler (Bio-Rad T100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:100 Murine RNase Inhibitor (NEB)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Gαq inhibitor YM-254890 (#257-00631) was purchased from FUJIFILM Wako Chemicals Europe (Nordic Biolabs, Täby, Sweden). Larixol was from two different sources ...
-
bioRxiv - Biochemistry 2020Quote: ... and RNAse free water and lastly 1.5 μL of T7 RNA polymerase (HiScribe T7 In Vitro Transcription Kit from New England Biolabs or AmpliScribe T7 High Yield Transcription Kit from Epicenter) ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were dialyzed with water on silica membranes (0.025 μm pores) for 1 hour before transformed into DH10β cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (CFU ...
-
bioRxiv - Cell Biology 2020Quote: ... samples in SDS containing sample buffer have been diluted with water to contain 0.5 % SDS and have been digested with Endo H (NEB) according to instructions by the manufacturer ...
-
bioRxiv - Zoology 2020Quote: ... The RNA pellet was resuspended with 30 µl of DNase/RNase free water and digested with DNase I (NEB) following the manufacturer protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... SmaI de-staining buffer (de-ionized water containing 1X cut smart buffer and 200 units of SmaI (NEB, #R01041S) in 500ul).
-
bioRxiv - Microbiology 2022Quote: ... A volume of ultrapure water needed to make the reaction up to 37.5μL after the addition of rCutsmart (NEB B6004S) and PspGI (NEB R0611 ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was isolated by precipitation in isopropanol-ethanol 75% and resuspended in 10 μL nuclease free water (NEB, B1500) before quantification by BioDrop μLITE (Biodrop) ...
-
bioRxiv - Genomics 2022Quote: ... and water to make up 49 µl) for three hours at 37°C after which 3 µl NlaII (NEB) was added and the reaction incubated at 37°C for a further three hours ...
-
bioRxiv - Microbiology 2022Quote: ... 160 µL of 40U/µL Taq DNA ligase and 699.36 µL of water (all reagents were purchased from New England Biolabs). 5 µL of the two DNA fragments mixture containing 100 ng of linear pRIT plasmid and a 3-fold excess of inserts were added to 15 µL of Gibson assembly master mix ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
Enhancer heterogeneity of lung neuroendocrine tumors reveals sensitivity to FGF signaling inhibitionbioRxiv - Cancer Biology 2023Quote: ... After precipitation RNA was resuspended in appropriate volume of Rnase free water supplemented with RNA inhibitors (New England Biolabs). RNA samples were stored at -80°C until further use ...
-
bioRxiv - Biophysics 2024Quote: ... Reactions were dialyzed with water on silica membranes (0.025-μm pores) for 1 h before transformed into DH10B cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (cfu ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 100 Units of ligase (M0202M, NEB)) ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 U PNGase F (New England Biolabs) was lyophilized (for up to 5 μg trimer) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 100 µg DNase I (NEB, M0303S). Cells were lysed using a Branson Sonifier (duty cycle ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10-100 nM M13mp18 scaffold (Bayou Biolabs) was incubated with an excess of staple strands (IDT) ...
-
Adaptive translational pausing is a hallmark of the cellular response to severe environmental stressbioRxiv - Molecular Biology 2020Quote: ... RNase inhibitor (1:100 dilution, NEB, M0314L), protease inhibitor (1 tablet per 10 mL ...
-
bioRxiv - Microbiology 2020Quote: ... or RNAse A/T1 (NEB, 100 Units) for 5min at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 µL of amylose resin (NEB E8021S) is equilibrated with 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... and 100 units of DraIII-HF (NEB) for 8-10h at 37° C ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1:100 proteinase K (NEB P8107S)) ...
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.6 uL 100 mM dithiothreitol (NEB, #B1034A), and water to a total volume of 24 uL ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µL dATP (100 mM) (NEB, N0446S), 1 µL SUPERase-In ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 U PNGase F (New England Biolabs) was lyophilized ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA markers of 100 bp ladder (NEB) and 1 kb ladder (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 ng of DNA in 50 ul water was used for library preparation using the Ultra II library kit (NEB) as per the manufacturer’s instructions with 6 cycles at the amplification step.
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2019Quote: ... Beads were washed twice with SPRI wash buffer and resuspended in 50 ul of end fill-in mix (37 ul water, 5 ul 10X NEB Buffer 2 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was eluted in RNase-free water and subsequently treated with Turbo DNase and purified using the Monarch RNA Cleanup Kit (50 µg) (NEB) and eluted in RNase-free water ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 40 μl of filtered double-distilled water and 20 or 30 μl of Blue Protein Loading Dye (New England Biolabs) were added to the beads or the inputs ...
-
bioRxiv - Cancer Biology 2019Quote: ... Biotinylated blunt ends were then ligated using a ligation reaction (663μl water, 120μl 10X NEB T4 DNA ligase buffer (NEB), 100μl 10% Triton X-100 (Sigma) ...