Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... and cloned between the two BsmBI sites of pCas9-tRp-gRNA by Golden Gate cloning (NEB) (Arazoe et al ...
-
bioRxiv - Microbiology 2022Quote: ... two complementary oligonucleotides with appropriate sticky end overhangs were annealed and ligated (T4 ligase NEB # M0202M) into the BsmBI-digested plasmid backbone ...
-
bioRxiv - Immunology 2023Quote: Phage DNA was subjected to two rounds of PCR using Q5 High-Fidelity 2X Mastermix (NEB), as previously described (Garrett et al. ...
-
bioRxiv - Pathology 2023Quote: ... The two U6-gRNA-trRNA cassettes were amplified and cloned by assembly (NEBuilder, New England Biolabs) in a pAAV already containing a pCAG-eGFP cassette.
-
bioRxiv - Developmental Biology 2024Quote: ... then the two halves collected in 200 µL of 1x RNA/DNA protection buffer (NEB #T2010S) in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1600 v/10 ms /3 pulses for 200,000 cells in Buffer R (Neon Transfection kit) premixed with 50 pmol Cas9 protein (CAT#M0646T, New England Biolabs), 50 pmol single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Physiology 2021Quote: ... The biotinylated peptides were placed on streptavidin-coated plates and three rounds of solid-phase panning were conducted using 109 random 12-mer peptides fused to a minor coat protein of M13 (pIII) following the manufacture’s protocol (Ph.D-12 Phage Display Peptide Library Kit, NEB, E8110S). Sequenced data were subsequently analyzed as follows ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... see Supplementary Data 6) and cloned into pDHFR vector provided in the PURExpress In Vitro Protein Synthesis Kit (NEB). The translation into liposomes was done as described previously95 and the output was analyzed by Blue Native PAGE using 2% digitonin and NativePAGE Novex 4-16% Bis-Tris Protein Gel (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... 20 ng of each integrase amplicon was used per reaction using PURExpress® In Vitro Protein Synthesis Kit (NEB) in a total volume of 9 µl ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were then mixed with Blue Protein Loading Dye (NEB) boiled for 10 minutes and separated on 10% SDS-PAGE gel for 50 minutes at 140 V ...
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Molecular Biology 2021Quote: ... two independent amplicons were generated by PCR using Q5 Hot Start High-Fidelity 2X Master Mix (NEB). One amplicon for the targeted locus and one amplicon of the pegRNA locus (primers listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Two microlitres of this reaction was then used as template for PCR using Taq DNA polymerase (NEB), DNA oligo E4 (CSO-4720) ...
-
bioRxiv - Biophysics 2020Quote: ... The central fragment and two labelled fragments were then ligated by incubation with T4 DNA ligase (NEB) overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The parA fragment and the two plasmid fragments were assembled using the Hifi DNA assembly mix (NEB). The construction was verified by sequencing.
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Microbiology 2021Quote: ... the cfp insert and the two plasmid fragments were assembled using the Hifi DNA assembly mix (NEB). The construction was verified by sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... Poly(A) RNA was isolated with two rounds of selection using oligo-(dT)25 beads (NEB, S1419S). 50 ng of poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... Two different Cas12a enzymes were used: EnGen® Lba Cas12a (Cpf1) (New England Biolabs, Ipswich, Massachusetts, USA) and Alt-R™ L.b ...
-
bioRxiv - Biochemistry 2023Quote: ... Two annealed oligonucleotides containing the homology region were phosphorylated by T4 polynucleotide kinase (New England Biolabs, M201) and cloned into the vectors pX335 and pKN7 (see Appendix Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in two stages of Polymerase Chain Reaction (PCR) using Q5 DNA polymerase (NEB). For the first PCR reaction ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified and assembled with the other two fragments using Gibson Assembly (New England Biolabs, Cat#E2611L). To complement Δgra47 parasites with either wild-type or site-directed histidine mutant derivatives ...
-
bioRxiv - Molecular Biology 2023Quote: ... each gDNA sample was divided into two and one aliquot was digested with StyI-HF (NEB, R3500S). Then ...
-
bioRxiv - Systems Biology 2024Quote: The dsDNA loxcode cassettes were formed by combining two purchased oligos (IDT) in a 50uL Q5 (NEB) polymerase reaction with the Q5 polymerase ...
-
bioRxiv - Genetics 2023Quote: pEAA734 (6.6 kb; DMC1, CEN6-ARSH4, URA3) was constructed using two-fragment HiFi assembly (New England Biolabs). The DMC1 open reading frame with 300 bp upstream and 296 bp downstream sequences was amplified from the SK1 genome with AO4920/AO4921 and cloned by HiFi assembly into pRS416 (Christianson et al ...
-
bioRxiv - Immunology 2024Quote: ... Genomic DNA was amplified in two rounds using NEBNext Ultra II Q5 HiFi polymerase (New England Biolabs). In PCR 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used 50 μL Protein A or Protein G Magnetic beads (NEB) and washed twice with PBS with 5 mg/ml BSA and 4 μg of antibody coupled in 500 μl PBS with 5 mg/ml BSA overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: All constructs encoding for the protein fragments that were used as the tagless analyte in SPR experiments were produced using the IMPACT protein purification kit (NEB) following the manufacturer’s guidelines for cloning and refolding from denaturing conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... K4A with K3WA) mutants of the full-length RAD51AP1 protein were generated by Q5 Site-Directed Mutagenesis kit (New England Biolabs) following the instructions of the manufacturer and the primer pairs listed in Table 1.