Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for Mouse Two pore calcium channel protein 2 Tpcn2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Forty-two microliters of sample were digested with DpnI (New England Biolabs) overnight to remove unreplicated pOri16LacZ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analytical amounts of twenty Argonaute proteins were synthesized from pET29a plasmids using PURExpress In Vitro Protein Synthesis kit (New England Biolabs, Inc., Ipswich, MA, USA). For large scale expression and purification of CbAgo ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1.5 mg of protein was cleaved in a 2 ml reaction with 240 Units of TEV protease (NEB) for two hours at 30 °C ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Biophysics 2023Quote: ... and DNA-bound proteins were released by MNase treatment (2 min 30° with 700 units of MNase NEB # M0247S) and analyzed by gel electrophoresis40.
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.6 µL of 10X GlycoBuffer 2 (Cat.#B3704S; New England Biolabs), 2.6 µL of 10% NP-40 (Cat.#B2704S ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tagged pore variant plasmids were constructed by Gibson assembly using NEBuilder HiFi DNA Assembly Master Mix (NEB), where the variant encapsulin genes were individually amplified by PCR from the untagged pore variant plasmids ...
-
bioRxiv - Microbiology 2020Quote: Fetuin was deglycosylated under denaturing conditions using Protein Deglycosylation Mix II kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PhyR1 and PhyR2 proteins were overexpressed and purified using the IMPACT kit (New England Biolabs) following the manufacturer’s instructions and equal procedures for the four of them ...
-
bioRxiv - Molecular Biology 2019Quote: ... in vitro translation was performed using the PURExpress In vitro Protein Synthesis kit (NEB 6800) and the non-stop ribosome complex was purified as previously described in ref.38 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was labeled with SNAP-Surface Alexa Fluor 647 labeling kit (New England Biolabs) according to the protocol provided by the manufacturer ...
-
bioRxiv - Biophysics 2022Quote: Plasmids expressing stdMCP-fusion proteins were generated using the NEBuilder HiFi DNA Assembly kit (NEB). To obtain plasmids carrying an stdGFP-tagged stdMCP gene ...
-
bioRxiv - Microbiology 2020Quote: ... amplified with the primers Dhm1275-1 and −2 (Table 2) using a NEBuilder HiFi DNA Assembly Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... 2 µL of Taq DNA polymerase (LongAmp Taq DNA Polymerase kit, New England Biolabs), 7.5 µL of dNTPs (dNTP set ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2(genomic) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2020Quote: The pIGLR-2∷mCherry construct was generated with a Gibson assembly cloning kit (NEB) with the following four fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... The M1879T mutant channel was constructed using site-directed mutagenesis PCR (Forward primer: AATACAGACGGAAGAGCGATTCATGGCATCAAACCC; Reverse primer: GCTCTTCCGTCTGTATTCGAAGGGCATCCATCTCTCC) with Q5 polymerase (New England Biolabs, Ipswitch, MA). The neonatal construct differed from the adult by inclusion of the neonatal exon 6N instead of the adult exon ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of tissue or cell lysates were treated with or without 2 μL Lambda Protein Phosphatase (LPP) (New England Biolabs) at 30 °C for 15 min (30 min for HEK-293E lysate ...
-
bioRxiv - Biochemistry 2019Quote: ... In the case of Biotinylated-AviTag-haBiP(28-635)T229A-V461F this protein was also made nucleotide free by the addition of 2 U CIP (NEB) per mg of BiP ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM of purified protein was combined with 2 mM DTT and 10 mM SNAP-Surface Alexa Fluor 546 (New England Biolabs) in PBS for 60 min at 30°C ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cells were isolated directly into low protein binding eppendorfs containing 2 ul NEBNext Single Cell Lysis Buffer (NEB, E5530S). Samples were kept on dry ice until transfer to −80 C for overnight storage.
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Genomics 2019Quote: ... After two washes in binding buffer and one wash in ligation buffer (NEB), PE adapters (Illumina ...
-
bioRxiv - Biochemistry 2019Quote: ... The two fragments were blunt-ended using the Klenow DNA polymerase fragment (BioLabs) and subcloned into the BamHI site of the recombinant plasmid pTE-KM71 ...
-
bioRxiv - Microbiology 2019Quote: ... Two different modified polymerase enzymes were evaluated for this method: Hemo KlenTaq (NEB) and Phusion Blood Direct (Thermo Fisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... These two fragments were ligated via Gibson assembly (New England BioLabs, Ipswich MA). The gRNA expression unit ...
-
bioRxiv - Microbiology 2021Quote: ... A ccdB lethal cassette was cloned between the two SapI (New England Biolabs) sites to aid in the efficiency of future protospacer cloning ...
-
bioRxiv - Microbiology 2021Quote: All bacterial two-hybrid plasmids were constructed using the Gibson assembly mix (NEB) or the Hifi DNA assembly mix (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... two inserts were amplified by PCR using Phusion polymerase (New England Biolabs M0530S) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2022Quote: ... after which the two were assembled together using Gibson assembly (New England Biolabs) to produce plasmid MSp198 ...
-
bioRxiv - Plant Biology 2022Quote: ... The two overlapping fragments were amplified using Q5 high-fidelity DNA polymerase (NEB) and introduced into the pJL89 vector by one-step NEBuilder Hifi assembly (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... These two gene fragments were used directly for DNA assembly (New England Biolabs) into pDSP9 ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation of the two digested fragments was achieved with T4 DNA ligase (NEB) followed by electroporation into E ...
-
bioRxiv - Plant Biology 2022Quote: ... The two PCR products were then assembled with Gibson Assembly Mastermix (NEB #E2611). All RDR1 constructs contain the genomic sequence of RDR1 (AT1G14790) ...
-
bioRxiv - Cell Biology 2023Quote: ... The two purified fragments were then ligated using T4 DNA ligase (NEB, M0202) following manufacturer’s instructions and transformed into competent cells (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... the two fragments were assembled using a Gibson assembly mix (NEB, no. E2611S) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Plasmids for yeast two-hybrid experiments were constructed using NEBuilder DNA assembly (NEB), Ligation High kit (TOYOBO) ...
-
bioRxiv - Systems Biology 2023Quote: ... Two transformations into NEB 10 beta electrocompetent cells (New England Biolabs, Ipswitch, MA) were performed as described above ...
-
bioRxiv - Cancer Biology 2023Quote: ... library was prepared using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA). The RNA-Seq libraries were sequenced on NextSeq 500 using the NextSeq 500/550 High Output Kit v2.5 (75 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were dialyzed with water on silica membranes (0.025 μm pores) for 1 hour before transformed into DH10β cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (CFU ...
-
bioRxiv - Biophysics 2024Quote: ... Reactions were dialyzed with water on silica membranes (0.025-μm pores) for 1 h before transformed into DH10B cells (New England Biolabs). Library sizes of at least 100,000 colony-forming units (cfu ...
-
bioRxiv - Bioengineering 2021Quote: 25 µl reactions were set up following the PURExpress protocol (In Vitro Protein Synthesis Kit, NEB) in black low-volume 384-well polystyrene plates (Corning) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Protein and non-incorporated nucleotides were removed using the Monarch RNA Clean up kit (NEB, T2040), before quantification by nanodrop.