Labshake search
Citations for New England Biolabs :
301 - 350 of 4001 citations for 4 nitro 5 ethyl 2 methylpyridine n oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: N-linked glycans were released from gp140 in-gel using PNGase F (New England Biolabs). The released glycans were subsequently fluorescently labelled with procainamide using 110mg/ml procainamide and 60mg/ml sodium cyanoborohydride ...
-
bioRxiv - Biochemistry 2020Quote: Tsetse salivary proteins were treated with peptide-N-glycosidase F (PNGase F, New England Biolabs), which cleaves all N-linked glycans except those with an α-1,3 fucose modification of the chitobiose core [20] ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX6P1-N-HA were transformed into BL21(DE3) competent cells (New England Biolabs, C2527H) and grown overnight at 37°C in a starter culture ...
-
bioRxiv - Cell Biology 2021Quote: The presence of N-linked oligosaccharides was examined using PNGase F (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: The presence of N-linked oligosaccharides was examined using PNGase F (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... N-linked glycans were released from gp140 in-gel using PNGase F (New England Biolabs). The released glycans were subsequently fluorescently labelled with procainamide and excess label and PNGase F was removed using Spe-ed Amide-2 cartridges (Applied Separations) ...
-
bioRxiv - Neuroscience 2019Quote: ... protein samples were treated with peptide-N-Glycosidase F (PNGase) (New England Biolabs, Whitby, ON) following manufacturers guidelines ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested genomic DNA by O/N incubation at 16°C with T4 DNA ligase (NEB). Subsequently ...
-
bioRxiv - Biophysics 2024Quote: ... N-glycosylation was removed by a 1-hour incubation with PNGase F (500 U, NEB) and following digest with sequence-grade trypsin (Promega ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 U of SssI (NEB) or 4 µl purified Eco72IM (diluted 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... in 1X NEBbuffer 4 (NEB #B7004), or an equivalent volume of ultra-pure water and 1X NEBbuffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl Klenow fragment (NEB M0212L) and 10 μl 10 nM dATP 20 min at 37 °C and 20 min at 75°C to inactivate the reaction ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10xG7 Buffer (NEB), 4 μl of 10% NP-40 (NEB ...
-
bioRxiv - Pathology 2019Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2019Quote: ... 4 µL Murine RNase inhibitor (NEB), 1 µL T7 polymerase (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Systems Biology 2019Quote: ... vaccinia mRNA 2’-O-methyltransferase (NEB, 250 U every 2 h) and water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... in the presence of m7G(5’)ppp(5’)G RNA Cap Structure Analog (NEB). 5 μg DENV-Luc RNA was electroporated into 2×106 Vero cells ...
-
bioRxiv - Genetics 2022Quote: ... The m7G(5’)ppp(5’)G RNA Cap (New England BioLabs, catalog number S1404L) was used as Cap Analog with 4:1 of Cap Analog:GTP ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’ ends were dephosphorylated using 5 U of Antarctic phosphatase (New England BioLabs/M0289S). A mix containing the RNA sample (~10 pmol) ...
-
bioRxiv - Genomics 2024Quote: ... the 5’ end of RNAs were enzymatically modified with RNA 5’ Pyrophosphohydrolase (RppH; NEB) and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL T4 PNK (NEB), and 1 µL Klenow large fragment (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL CutSmart buffer (NEB), and 30 μL of nuclease-free water and incubated for 1 h at 37 °C and 10 min at 80 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL HinFI enzyme (NEB), 5 μL ExoI buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μL ExoI buffer (NEB), 5 μL CutSmart buffer (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... and SacII (NEB, Figure 5) overnight at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... and 5-mdCTP (NEB #N0365S)) similar to T-WGBS (Lu et al ...
-
bioRxiv - Genetics 2021Quote: ... RNAse H (5 Units, NEB), rSAP (1 Unit ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl CviQI (NEB R0639S), and 5 μl CviAII (NEB R0640S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25U 5’ Deadenylase (NEB, #M0331S), 30U RecJ endonuclease (NEB ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli NEB 5-alpha (NEB) and plated onto medium with the cognate antibiotic ...