Labshake search
Citations for New England Biolabs :
101 - 150 of 4001 citations for 4 nitro 5 ethyl 2 methylpyridine n oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Neuroscience 2023Quote: ... N-glycans were released using N-glycanase PNGase F (1239U/ml, New England BioLabs, Inc. cat no. P0709L) and were fluorescently labelled with 2-aminobenzamide (2-AB ...
-
bioRxiv - Bioengineering 2022Quote: ... or 1 μg Asp-N (NEB, England) for overnight digestion respectively ...
-
bioRxiv - Immunology 2020Quote: ... deglycosylated with N-glycanase (New England Biolabs), and digested overnight with LysC protease (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... or N-glycosilase F (PNGaseF, NEB P0704S), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... endoproteinase Asp-N (New England Biolabs, #P8104S), Glu-C (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Biochemistry 2020Quote: ... Trypsin digest of PDI was followed by digestion of N-glycans with endo-β-N-acetylglucosaminidase H (500 U; NEB) in sodium citrate buffer (50 mm ...
-
bioRxiv - Microbiology 2022Quote: ... Peptide-N-Glycosidase F (PNGase F; NEB, P0704) treatment of lysates was performed as described in the manufacturer’s directions ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli BL21 lysY/Iq (NEB cat n° C3013). The expression plasmid was transformed via heat-shock followed by selection of clones on LB-Agar plates supplemented with 100 µg/mL carbenicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were incubated with 2 nM HaloTag-JF549 and 5 nM SNAP-Cell® 647-SiR (NEB) before imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then incubated at 45 °C for 2 hr with 5 μL of Proteinase K (NEB) in the presence of 40 mM EDTA (pH 8.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... mixing with 5 μL of stop buffer (50 mM EDTA and 2 mg/ml Proteinase K (NEB)) ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... VCE or FCE::T7RNAP fusion and 5 U/μL vaccinia cap 2′-O-methyltransferase (New England Biolabs). Reactions were carried out at indicated temperatures for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... After CIP inactivation (2 min at 80°C) piRNAs were 5΄end radiolabeled by T4 PNK (NEB) with [γ-32P] ATP (10mCi/mL ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins were expressed and purified from 2 to 4 liters of Escherichia coli NiCo21(DE3) (New England Biolabs) as previously described (24) ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were amplified for N-1 cycles (being N the optimum Cq determined by qPCR reaction) using NEBNext High-Fidelity Polymerase (New England Biolabs, M0541). Libraries were purified with Sera-Mag Select Beads (GE Healthcare ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2022Quote: ... gRNAs were annealed in (1 μl Forward primer, 1 μl Reverse primer, 5 μl Buffer 4 NEB, 43 μl H2O) by heating at 98 °C for 5 min and allowing the tubes to cool down to room temperature in the thermoblock (∼3h) ...
-
bioRxiv - Biochemistry 2023Quote: ... The duplex hRNase 4 cleavage products (5′ fragments of the RNA) were enriched using Hydrophilic Streptavidin Magnetic Beads (New England Biolabs). The beads were washed twice by a high salt buffer (5 mM Tris HCl ...
-
bioRxiv - Immunology 2019Quote: ... Single cells were flow-sorted into 96-well plates containing 2 µL of nuclease-free water with 0.2% Triton X-100 and 4 U murine RNase inhibitor (NEB), centrifuged ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in 1× Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Microbiology 2023Quote: ... Annealing was performed with 4 µM (final) of each guide oligo and 0.5-2 µg of template DNA in 1x Cutsmart buffer (NEB) using a slow temperature gradient (95°C – 60°C at 0.1°C / sec ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Microbiology 2021Quote: ... Peptide-N-glycosidase F (PNGase F) (New England BioLabs) was used to remove all N-linked oligosaccharides for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... as N-terminal VP16 fusions using HiFi assembly (NEB). The human ERG ETS domain ...
-
bioRxiv - Microbiology 2022Quote: ... or for peptide N-glycosidase F (PNGase-F, NEB) digestion using 500 units PNGase-F for 1,5h at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... the sample was deglycosylated with N-glycosidase F (Biolabs) and Sialidase A (Prozyme ...
-
bioRxiv - Biochemistry 2023Quote: ... N-glycans were released with PNGase F (NEB, P0709) for 20 h at 37 °C and the released N-glycans were isolated by passage through a pre-washed 10 kDa MWCO filter ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Non-encapsidated nucleic acids were removed by mixing 900 μL of each sample with 100 μL 10x DNase buffer and supplemented with 2 μL (4 U) of DNase I (NEB) and 1 U of RNase ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Transformations for integration onto p1 were performed as described previously:15 2–4 µg of plasmid DNA with ScaI restriction sites adjacent to integration flanks was cut with ScaI-HF (NEB) and transformed into yeast harboring the wt p1 and p2 plasmids ...
-
bioRxiv - Genomics 2021Quote: ... Purified RNA was fragmented 2-4 minutes (depending on the RNA Integrity Number) using NebNext Magnesium RNA Fragmentation Module (New England Biolabs) and once again purified with the RCC kit (Zymo Research ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...