Labshake search
Citations for New England Biolabs :
151 - 200 of 4001 citations for 4 nitro 5 ethyl 2 methylpyridine n oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Immunology 2022Quote: ... Sample index PCR: 2 µl tagging PCR product was mixed with 18 µl PCR mix (4 µl 5x phusion HF buffer (NEB); 0.4 µl Phusion DNA Polymerase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 µl of CutSmart buffer and 2 µl of EcoRI-HF® (New England Biolabs, catalog no. R3101) were added before incubation for 6 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The N expression plasmid was linearized using EcoRV-HF (NEB). Capped-RNA was produced using the mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... or peptide N-glycanase (PNGase, New England Biolabs, 1,000 units) for 6 h ...
-
bioRxiv - Microbiology 2022Quote: ... N-glycans were isolated by treatment with PNGase F (NEB) under denaturing conditions followed by solid phase extraction purification ...
-
bioRxiv - Biochemistry 2023Quote: ... the N-glycans were released using peptide:N-glycosidase F (NEB, in 50 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gluc200 and Gluc200A44 templates were generated using PCR amplification of GLuc of the first 200 nt at the 5’end of pCMV-GLuc 2 Control Plasmid (NEB: https://www.neb.com/tools-and-resources/interactive-tools/dna-sequences-and-maps-tool) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 μl of the assembled mix (∼5 ng of vector backbone) was transformed into competent cells (NEB, cat# C2987H), followed by spreading on antibiotic-selective LB agar plates ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... was digested with BbsI enzyme and pre-annealed 5’-end phosphorylated sgDNA sequences (found in Extended file 2) inserted using Quick Ligase (New England Biolabs), and subsequently transformed into Stabl3 TM E ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and digested with 200U DpnII (New England Biolabs, Cat. N: R0543) overnight at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... N-glycans were digested using PNGase-F (New England Biolabs, P0704S) essentially according to manufacturer’s protocol but with a three-hour incubation at 37 °C.
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... glycerol-free peptidyl-N-glycosidase F (PNGase F) (New England Biolabs), Endoglycosidase Hf (Endo Hf ...
-
bioRxiv - Bioengineering 2020Quote: ... reesei strain by peptide N-glycosidase F (PNGase F, NEB, P0704) (Wang et al ...
-
bioRxiv - Immunology 2021Quote: ... BbvCI (cat. n° R0601L, NEB, New England Biolabs, Ipswich, MA, USA), to obtain the linearized plasmid ...
-
bioRxiv - Genetics 2022Quote: ... at the N-terminal by using SalI (New England Biolabs, # R3138S) and NotI (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... or Peptide-N-Glycosidase F (PNGase F) (New England Biolabs, #P0704S) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 1 mM CaCl2 and treated with N-glycanase (New England Biolabs) for 1 hour at 37°C.
-
bioRxiv - Molecular Biology 2023Quote: ... and m7Gppp5′N cap was added using Vaccinia Capping System (NEB). To induce superovulation ...