Labshake search
Citations for New England Biolabs :
251 - 300 of 4001 citations for 4 nitro 5 ethyl 2 methylpyridine n oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Biochemistry 2020Quote: ... tsetse saliva was treated with peptide-N-glycosidase A (PNGase A, New England Biolabs), which releases all N-linked glycans ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysuccinimide ester (BG-GLA-NHS) functionalized benzylguanine was purchased from NEB (Cat #S9151S) and freshly reconstituted in DMSO to a final concentration of 83 mM ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Molecular Biology 2022Quote: Removal of N-linked glycosylation was performed using PNGaseF (New England Biolabs, Ipswich, USA) at a concentration of 125 U/μg protein ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...
-
bioRxiv - Immunology 2021Quote: ... 1 µL of 10 mM dNTP (cat. n° N0447L, NEB, New England Biolabs, USA), 0.2 µL of RNase Inhibitor 40 U / µL (cat ...
-
bioRxiv - Biochemistry 2022Quote: ... The N-terminal deletions were made using the HiFi DNA cloning kit from NEB to excise portions of the N-terminus of the gene ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans were removed using endoglycosidase H (Endo Hf, New England BioLabs, P0703). De-glycosylated VISTA protein was separated from Endo Hf via additional nickel affinity chromatography ...
-
bioRxiv - Microbiology 2021Quote: ... removal of N-glycans was performed by digestion with PNGaseF (New England Biolabs, P0704S), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Deglycosylation was performed with peptide-N-glycosidase F (PNGase F; New England Biolabs, USA) following the manufacturer’s instructions [28] ...
-
bioRxiv - Cell Biology 2022Quote: ... and ligated into pcDNA5/FRT/TO-N-FLAG-BirA* using Quick Ligation Kit (NEB). Top10 competent E ...
-
bioRxiv - Genomics 2019Quote: ... and 4 U MmeI (NEB) for 2 h at 37 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 (NEB #E7500) and 3 (NEB #E7710 ...