Labshake search
Citations for New England Biolabs :
3151 - 3200 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Microbiology 2020Quote: The real-time PCR technique was performed for NDV detection using Luna Universal One-Step RT-qPCR Kit E3005E (New England BioLabs, USA) following the manufacture procedures ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... A silent point-mutation was introduced to remove the BbsI recognition site within the blasticidin sequence to allow the subsequent insertion of one gRNA by SapI (NEB, R0569) cloning into the h7SK expression cassette and the second gRNA by BbsI (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA preparations were then used directly for qPCR (200 ng total RNA per reaction) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3006) and target-specific primer/probe sets (ThermoFisher ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were prepared as described above except one library was first treated with USER enzyme (New England Biolabs, Ipswich, Massachusetts, USA) for 30 min to remove deaminated cytosine damage ...
-
bioRxiv - Developmental Biology 2019Quote: ... One replicate of each ChIP-seq library was prepared with NEBNext ChIP-seq Library Prep Master Mix Set (NEB, Cat#E6240S) using insert size selection of 250 bp ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was carried out using NEB Luna Universal Probe One-Step Reaction Mix and Enzyme Mix (New England Biolabs, Herts, UK), primers and probe at 500 nM and 127.5 nM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) using corresponding primers and probe (MS2_F ...
-
bioRxiv - Microbiology 2020Quote: ... qRTPCR was performed with primers mentioned in Table S3 with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Log2 normalized RNA abundances were calculated using ValidPrime signal as reference (51).
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed either directly on the inactivated supernatants or on extracted RNA using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005E) in a QuantStudio 6 thermocycler (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng total RNA per 20 µl reaction were analyzed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006) in technical triplicates ...
-
bioRxiv - Molecular Biology 2022Quote: The rest of RNAs were performed with real-time reverse transcription PCR (RT-qPCR) using a Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) according to the manufacturer’s recommendations by a thermocycler (BIO-RAD CFX96™ Real-Time System) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 575 embryos were injected with a mixture containing 300 ng/μL of sgRNA (one guide) and 600 ng/μL of Cas9 protein (NEB, M0641) while for Dll ...
-
bioRxiv - Plant Biology 2022Quote: ... and LCM cell sample collections (ME, TAP, and OSC) was performed using the Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Quantitative PCR was performed using TaqMan primers synthesized by Integrated DNA Technologies (Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification of the replication of each mutant versus the reference was performed using Luna® Universal Probe One-Step RT-qPCR kit (New England BioLabs) containing 3uL of total RNA ...
-
bioRxiv - Microbiology 2022Quote: ... One-step quantitative RT-PCR was used to determine gene expression levels using the Luna Universal One-Step RT-qPCR kit (New England Biolabs Inc.) according to the manufacturer’s recommendations using 4 ng of total RNA per 20µl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Microbiology 2022Quote: ... 1-step RT-qPCR was performed on 2μL of RNA using the Luna® Universal One-Step RT-qPCR Kit (NEB Biosciences) and primers for β-tubulin (F ...
-
bioRxiv - Genomics 2022Quote: ... The incomplete ligation product (fragment having only one or no adaptor ligated) was removed using exonuclease (NEB ExoIII and NEB ExoVII). Two nick sites were created at the Uracil positions in the hairpin adapters at both ends after being treated with UDG (NEB ...
-
bioRxiv - Genomics 2022Quote: ... The incomplete ligation product (fragment having only one or no adaptor ligated) was removed using exonuclease (NEB ExoIII and NEB ExoVII). Two nick sites were created at the Uracil positions in the hairpin adapters at both ends after being treated with UDG (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... One µg of total RNA was used for the NEBNext® Ultra™ Directional RNA Library Prep Kit (New England Biolabs) without removing ribosomal RNA ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were carried out in 10 μL reactions using the Luna® One-Step Universal RT-qPCR kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and the pHW2000 plasmid backbone such that the whole plasmid could be assembled in a one-pot golden gate reaction with PaqCI (NEB, #R0745S). Due to repeated regions ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated using a 12% SDS-PAGE and mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Microbiology 2023Quote: ... were assembled by hybridisation of complementary oligonucleotides with one oligonucleotide being radiolabelled with [γ-32P]-ATP by T4 polynucleotide kinase (NEB). 15 µl EMSA samples contained 800 pM DNA template ...
-
bioRxiv - Microbiology 2023Quote: RNA was used as template to detect and quantify viral genomes by duplex reverse transcriptase (RT) quantitative polymerase chain reaction (RT-qPCR) using a Luna Universal Probe one-step RT-qPCR kit (New England Biolabs, E3006E). SARS-CoV-2-specific RNAs were detected by targeting the ORF1ab gene using the following set of primers and probes ...
-
bioRxiv - Genomics 2022Quote: ... mScarlet and HPRT (housekeeping gene for normalization) levels were then measured by qPCR using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005) with 100ng total RNA per reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each sample for resection analysis was divided into two aliquots and one aliquot was digested with the Sty-I-HF (NEB, R3500S) restriction enzyme ...
-
bioRxiv - Microbiology 2023Quote: ... Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.), without the reverse transcriptase enzyme ...
-
bioRxiv - Plant Biology 2024Quote: ... Assembly reactions were performed by a one-pot mixture that consists of Type II restriction enzymes with T4 DNA ligase (NEB, USA) as described in Sauret-Gueto et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... 500 ng total RNA was used as template with the Luna Universal One-step RT-qPCR kit (New England Biolabs, E3005L). For each condition 3 biological replicates with two technical replicate RT-qPCR reactions were run on a CFX96 Connect Real-Time System (BioRad) ...
-
bioRxiv - Biochemistry 2024Quote: The pET15b-CtTrl1-LIG plasmid22 served as template for PCR-based site direct mutagenesis with one oligonucleotide for K148N and E328-stop (ΔCTD) variants or two oligonucleotides and Q5® Site-Directed Mutagenesis Kit (NEB) to introduce R334A ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...