Labshake search
Citations for New England Biolabs :
3001 - 3050 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and were assembled into pHaloTag-C1 to produce the pHalo-Baf in one-step using the Gibson Assembly Master Mix (New England Biolabs). The cGAS cDNA was amplified by the KOD One from pLPC-cGAS-Flag (Dou et al. ...
-
bioRxiv - Genomics 2020Quote: ... One microgram of DNase-treated total RNA was reverse transcribed using AMV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and a gene-specific primer for either the germline-limited gene or actin II control ...
-
bioRxiv - Microbiology 2019Quote: ... samples were diluted to 5ng/uL and used for qRT-PCR with Luna One-Step Universal qPCR kit (NEB E3005). Gene specific primers for target transcripts were used at a final concentration of 400uM with 15ng of RNA ...
-
bioRxiv - Systems Biology 2020Quote: ... One microgram of purified RNA was fragmented at 95 °C for 7 min in 1X T4 RNA Ligase buffer (NEB) with an equal volume of 2X alkaline fragmentation buffer (0.6 volumes of 100 mM Na2CO3 plus 4.4 volumes of 100 mM NaHCO3) ...
-
bioRxiv - Genomics 2019Quote: ... Ligated RNA was enriched with biotin-labeled products by another round of Streptavidin bead binding and washing (two washes each of High, Binding and Low salt buffers and one wash of 1x Thermo Pol Buffer (NEB)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). RNA was then subjected to fragmentation using RNA Fragmentation Reagents (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... was incubated with 2 μΜ biotinylated oligo complementary to one of the two 12 nt cohesive ends in λDNA in T4 DNA ligase reaction buffer (NEB) and hybridized at 70°C for 15 min followed by cooling to 15°C over 2 h ...
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... A HiFi assembly reaction was then performed to join the PCR product with the linear pEERM1 to form the assembled circular plasmid by incubating at 50 °C for one hour using NEBuilder DNA HiFi Assembly Master Mix (New England Biolabs). The HiFi reaction solution (5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...
-
bioRxiv - Immunology 2020Quote: ... the first one obtained by digesting the pcDNAI-GAL4-CREB vector with EcoRI and XbaI restriction enzymes (New England Biolabs), and the second part obtained by amplifying either the extracellular or the intracellular coding regions of the MerTK vector by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... RNA levels of target proteins were subsequently quantified by using RT-with the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermocycler using gene-specific primers ...
-
bioRxiv - Microbiology 2022Quote: The copy number of viral RNAs were titrated by qRT-PCR using Luna Universal Probe One-Step RT-qPCR Kit (NEB) and LightCycler 96 instrument (Roche) ...
-
bioRxiv - Genomics 2022Quote: Real-time PCR (RT-PCR) amplification of RNA was performed following the Luna Universal One-Step RT-qPCR kit (New England Biolabs). A CFX 96 Touch Real-Time PCR Thermocycler/ Detection System (Bio-Rad ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for up to one month until used for purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). Five larvae were pooled for each RNA purification and homogenized in DNA/RNA protection buffer with a glass homogenizer prior to proteinase K digestion ...
-
bioRxiv - Molecular Biology 2019Quote: ... First strand cDNA synthesis was performed for one hour at 42 °C using M-MuLV Reverse Transcriptase (New England Biolabs). Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... The remaining 50 μL was used as input for one round of end repair and adapter ligation with NEBNext Ultra II DNA Library Preparation kit (NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... This plasmid was digested with XbaI and NheI enzymes to release TcZC3H12-HA sequence followed by the Neomycin expression cassette and treated with One Taq DNA polymerase (NEB) to allow for cloning in pCR2.1-TOPO plasmid (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Microbiology 2020Quote: ... separate reactions were performed for the quantification of SARS-CoV-2 N and E gene transcripts as well as cellular RNaseP for normalization using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) on a Bio-Rad CFX384 Touch system ...
-
bioRxiv - Microbiology 2021Quote: ... A 523bp fragment of ERV-DC7 or ERV-DC16 env genes was then amplified by PCR using One Taq DNA Polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... tropicalis pseudouridine synthase Pus7 was amplified from total RNA using the OneTaq One-step RT-PCR kit (New England Biolabs). XmaI and XhoI restriction sites were added with oligonucleotides and the resulting fragment was cloned into the p415Gal1 vector.
-
bioRxiv - Genomics 2020Quote: ... was incubated at room temperature for one hour with a mixture of 10 μl 5X Quick ligation buffer (New England BioLabs), 16μl nuclease-free water (Ambion) ...
-
bioRxiv - Biophysics 2020Quote: ... was functionalized at one end by annealing with a biotinylated oligonucleotide/5Phos/AGGTCGCCGCCCTTTTT/Bio (IDT) followed by ligation with T4 DNA ligase (NEB). The DNA was purified using a bead purification kit (Qiaex II ...
-
bioRxiv - Microbiology 2022Quote: ... from the original pSAG1-Cas9-GFP-UPRT (Shen et al., 2014)) for one targeting the LFM1 locus using the Q5 site-directed mutagenesis kit (NEB). 1 µg of the cassette and 1 µg of Cas9 plasmid were transfected into the LMF1-HA cell line using the Lonza nucleofection system ...
-
bioRxiv - Microbiology 2022Quote: ... To perform the qRT PCR we followed the recommendations of the manufacturer Luna Universal One-Step qRT-PCR Kit (New England BioLabs Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: Detection of viral genomes from heat-inactivated samples was performed by RT-qPCR using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 specific primers targeting the N gene region (5′-TAATCAGACAAGGAACTGATTA-3′ and 5′-CGAAGGTGTGACTTCCATG-3′ ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 500 ng DNase I treated total RNA or mRNA of one technical replicate was fragmentated to ~150 nt by magnesium RNA fragmentation buffer (New England Biolabs) for 4 min at 94°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 100 ng of total RNA was used in the detection and quantification of TgCPDH transcripts using the Luna Universal One-Step RT-PCR kit (NEB). Data acquisition was collected using the BioRad CFX96 Touch Real-Time PCR detection system ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.2 µM of each primer were amplified with 0.5 units of One Taq DNA polymerase (Biolabs, Ipswich, MA, USA). Cycling conditions were established with an initial denaturation step at 95°C/2 min followed by 40 cycles at 95 °C/45 s ...