Labshake search
Citations for New England Biolabs :
2951 - 3000 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Zoology 2022Quote: ... mRNA cap 2’-O-methyltransferase (NEB) and E ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl T4-PNK buffer (NEB), 2 µl T4-PNK (10 U/µl ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 2 (TOYOBO) and BsaI-HF (NEB) and incubated at 37℃ for 5 min and 16℃ for 5 min for three cycles ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x CustSmart buffer (NEB), 1 µl EcoRI enzyme (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl Q5 DNA Polymerase (NEB). Amplification was done with an initial denaturation at 95 °C for 30 sec followed by 40 cycles at 95 °C for 10 sec ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... 2 × RNA loading dye (NEB, #B0363S) were added to the system to stop the reaction and the RNA was separated by agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 μL BlpI (NEB cat# R0585S) + nuclease-free water to 50 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U of quick CIP (NEB), and water as needed ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 RNA ligase 2 (M0239S, NEB), Leupeptin (PI78435 ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... followed by the addition of 5 μl of UDG reaction solution (New England Biolabs, 0.02 U μl−1 UDG in 1X UDG buffer) and an additional 30 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was slowly cooled down to room temperature with a Δ -1°C / second gradient and 0.5 μl of each RNase H (NEB, 5 U/μl), RNase T1 (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... The single stranded cDNA was ligated with a partial Illumina 5’ adaptor (HZG885:/5phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTddC) using T4 RNA ligase 1 (New England Biolabs, Ipswich, MA, US) and incubated overnight at 22 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DCR1 ORF along with its upstream and downstream sequence was amplified (primers: DCR1-Intergenic-For 5′-CCCCCTCGAGTTTGTAAAGAAATTGATGCTTCG; DCR1-Intergenic-Rev 5′-TGCAGGATCCGAATCTGGTATGGGATCATATTGG) and inserted between the XhoI and BamHI (NEB) restriction sites of pRS402.
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... The AGO1 ORF along with its upstream and downstream sequence was amplified (primers: AGO1-Intergenic-For 5′-GCTGGAGCTCTGAACGTGTGGAAGACCAAA; AGO1-Intergenic-Rev 5′-ATGACTCGAGAGTGGCTAACGGCAACATATC) and inserted between the SacI and XhoI (NEB) restriction sites of pRS404 ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Systems Biology 2020Quote: ... and at least 1 μg but no more than 5 μg DNA was put into an end-resection reaction (5 U T4 DNA Polymerase, NEB) to remove biotin from unligated ends ...
-
bioRxiv - Microbiology 2021Quote: ... Linearized DNA was purified by phenol/chloroform extraction and RNA was in vitro transcribed in the presence of G(5’)ppp(5’)G RNA Cap structure analog using SP6 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Genomics 2022Quote: Add 5 μl of dNTP mix (10 mM each) and 5 μl of DNA polymerase I Klenow fragment (NEB, M0210) to the reaction system ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... BSP1 was amplified from genomic DNA with primers 5’-ctggaagttctgttccaggggcccatgacaaaatatgagcgtgaccctg and 5’-ccccagaacatcaggttaatggcgttacacgcgtgttggaagttttcttc while pCoofy3 was linearized with primers 5’-cgccattaacctgatgttctgggg and 5’-gggcccctggaacagaacttccag using Q5 High-Fidelity 2X Mastermix (New England Biolabs). After DNA fragments were purified from agarose gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Microbiology 2023Quote: ... and ligating 5 µL of 5 µM spacers (annealed oligos) with 80ng of BsaI-digested backbone using the T4 ligase (NEB). We chose spacer sequences based on protospacer position and their association with a 5’-AAG-3’ motif and annealed them from two oligonucleotides with the according restriction site overhangs (95 °C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... Second DNA adapters (containing 5 [N5] or 10 [N10] random bases at the 5′-end) were ligated to the 5′-end of the cDNA (T4 RNA Ligase, NEB). The DNA was amplified by PCR and purified with PippinPrep system (Sage Science ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs). Quantitative real time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...