Labshake search
Citations for New England Biolabs :
3051 - 3100 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Microbiology 2024Quote: ... primers were designed to clone Ceg10 into pET28b using restriction enzymes NdeI and NotI by HiFi DNA Assemby kit (NEB; Table S4), producing the His6x-TEV-Ceg10 vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Genomics 2023Quote: ... An additional USER treatment step was performed to the purified DNA by adding 2μl USER (included in all the NEB index primer kits) and incubating for 15 min at 37⍰ ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Genomics 2024Quote: ... and amplified using ISOSDB412 IS-Seq Step1 and p7 primers for 13 cycles using Q5 Master Mix (New England Biolabs, Ipswich, MA). The products of this reaction were amplified with IS-Seq Step2 and p7 primers for 9 cycles using Q5 Master Mix and sequenced on a Novaseq 6000 at Novogene (Sacramento ...
-
bioRxiv - Molecular Biology 2024Quote: ... and joining SEGS-1F and SEGS-1G using the indicated primers in Supplementary Figure 1 and the Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA). All the primers except for those for site-directed mutagenesis added NotI restriction sites at the 5’ and 3’ends of PCR products ...
-
bioRxiv - Neuroscience 2024Quote: ... and the variable regions of the AAV library amplified using serotype-specific primers and the NEB Q5 2x Master Mix (New England Biolabs, Ipswich, MA). Amplicons were incorporated into recipient plasmids by Gibson assembly and transformed into Endura electrocompetent cells (LGC ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µM GAT-7N random hexamer primers with an adapter sequence and 2 units/µl DeepVent® (exo-) DNA polymerase (New England Biolabs, M0259L). DNA was further amplified as in the pre-amplification step above ...
-
bioRxiv - Cell Biology 2020Quote: ... Expression of mRNA transcripts for PfRFC1 gene analysis were carried out using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Inc.), on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... Total RNA preparations were then used directly for qPCR (200 ng total RNA per reaction) using the Luna Universal One-Step RT-qPCR Kit (NEB, E3006) and target-specific primer/probe sets (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... 800 nanograms of Poly(A)-tailed and capped RNA – 200 ng per construct – was ligated to ONT RT Adaptor (RTA) using concentrated T4 DNA Ligase (NEB-M0202T), and was reverse transcribed using SuperScript III RT (Thermo Fisher Scientific-18080044) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 250 ng total of polyA tailed yeast RNAs were ligated to pre-annealed custom RT adaptors (IDT) (Smith et al., 2019) using concentrated T4 DNA Ligase (NEB-M0202T), and was reverse transcribed using Maxima H Minus RT (Thermo Scientific ...
-
bioRxiv - Genomics 2021Quote: ... and a portion corresponding to 1 µg input RNA was converted to cDNA using the LunaScript RT SuperMix cDNA synthesis kit (NEB E3010). 1% of the cDNA was used for each qPCR reaction performed with the Luna Universal qPCR Mastermix (NEB M3003 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs) using corresponding primers and probe (MS2_F ...
-
A small molecule reveals role of insulin receptor-insulin like growth factor-1 receptor heterodimersbioRxiv - Cell Biology 2021Quote: ... Reverse transcription of RNA to cDNA was performed by combining 500 ng/ mL of the RNA samples with the LunaScript™ RT SuperMix (5X) (NEB) in 20 μL aliquots ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed either directly on the inactivated supernatants or on extracted RNA using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005E) in a QuantStudio 6 thermocycler (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... and gene expression was analyzed by RT-qPCR on QuantStudio 6 (Applied Biosciences) using the Luna Universal qPCR kit (New England Biolabs, M3003). Relative expression was normalized to Actb and Gapdh housekeeping genes and was determined using the ΔΔCt method ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng total RNA per 20 µl reaction were analyzed using the Luna Universal Probe One-Step RT-qPCR Kit (NEB, # E3006) in technical triplicates ...
-
bioRxiv - Plant Biology 2022Quote: ... and LCM cell sample collections (ME, TAP, and OSC) was performed using the Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs). Quantitative PCR was performed using TaqMan primers synthesized by Integrated DNA Technologies (Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Quantification of the replication of each mutant versus the reference was performed using Luna® Universal Probe One-Step RT-qPCR kit (New England BioLabs) containing 3uL of total RNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... 800 nanograms of Poly(A)-tailed and capped RNA — 200 nanograms per construct-was ligated to ONT RT Adaptor (RTA) using concentrated T4 DNA Ligase (NEB-M0202T), and was reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific-18080044) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... were heated to 65°C and slow-cooled to 37°C before reverse transcription with 5 U AMV-RT (NEB, M0277L) at 42°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Genomics 2021Quote: ... The sample was then allowed to cool to room temperature and incorporated in the Klenow enzyme mix (1x Maxima h-RT buffer, 1mM dNTP, 1U/μL of Klenow Exo-; NEB M0212L) was added to the single strand library ...
-
bioRxiv - Microbiology 2022Quote: ... The viral cDNAs were synthesized from extracted RNA using the Luna Script RT Super Mix Kit (New England BioLabs, Ipswich, MA), followed by DNA amplification by multiplex PCR in two separated primer pools using ARTIC-N5 primers (59 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was diluted 1:25 in water and used as template for RT-qPCR using the Luna Universal qPCR master mix (NEB M3003S). Primers used are listed in Supplementary Table 3 ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a template to prepare 10 μl cDNA using LunaScript®RT SuperMix Kit (New England Biolabs, cat# E3010L) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNA was quantified by ultraviolet spectrophotometry and 1 μg used for reverse transcription by LunaScript® RT SuperMix Kit (New England Biolabs), as described by the manufacturer ...
-
bioRxiv - Genomics 2022Quote: ... 500 ng poly-A RNA or poly-A tailed IVT RNA was ligated to the ONT RT adaptor (RTA) using T4 DNA Ligase (NEB, M0202M). Then the product is reverse transcribed using SuperScript™ III Reverse transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... an optional PBS wash followed by Red Blood Cell lysis step was included (10 mins at RT) prior to hypotonic lysis with Nuclei Prep Buffer (NEB, Cat.T3052) and Rnase digestion ...
-
bioRxiv - Neuroscience 2024Quote: ... and 100 ng of RNA was reverse-transcribed into cDNA using the LunaScript RT Master Mix Kit (New England Biolabs #E3025L). qPCR reactions utilized specific primers and were performed in triplicate with Applied Biosystems TaqMan Gene Expression Master Mix (ThermoFisher #4369016) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Genomics 2023Quote: ... 800 ng of poly(A)-tailed RNA (200 ng per curlcake construct and 250 ng per riboswitch) was ligated to ONT RT Adaptor (RTA) using concentrated T4 DNA Ligase (NEB, M0202T). The optional reverse transcription step was performed using SuperScript III (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: RNA extracts from WWI samples were reverse transcribed to synthesize cDNA using the LunaScript SuperMix RT kit (New England Biolabs, E3010L); 10 µL of each RNA extract was used in a total reaction volume of 20 µL ...
-
bioRxiv - Plant Biology 2023Quote: ... The purified total RNA was used to synthesize cDNA using LunaScript® RT SuperMix Kit (New England Biolabs, catalog number E3010).
-
bioRxiv - Plant Biology 2023Quote: ... The purified total RNA was used to synthesize cDNA using LunaScript® RT SuperMix Kit (New England Biolabs, Catalog number E3010). The synthesized cDNA was analyzed using qPCR using Luna® Universal qPCR Master Mix (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... The mutant and wild-type target RNA were subsequently amplified using either the NEB Luna SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB E3019), Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019 ...
-
bioRxiv - Genomics 2022Quote: ... mScarlet and HPRT (housekeeping gene for normalization) levels were then measured by qPCR using the Luna Universal One-Step RT-qPCR Kit (NEB #E3005) with 100ng total RNA per reaction ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was used as a template for cDNA synthesis with the LunaScript® RT SuperMix Kit (#E3010, New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... each custom RT adapter was ligated to 500 ng of rRNA-depleted and polyA-tailed RNA samples using T4 DNA Ligase (NEB M0202L), which was followed by reverse transcription using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of total RNA were ligated to the pre-annealed custom RT adaptors (21) using concentrated T4 DNA Ligase (NEB-M0202T). Ligated RNA was reverse transcribed using Maxima H Minus RT (Thermo Scientific ...
-
bioRxiv - Genomics 2023Quote: ... Included in the gel as controls were an RT reaction conducted in the absence of tRNA and a Small Range RNA Ladder (NEB N0364S). The gel was stained with SYBR gold and visualized using a ChemiDoc imager (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 250ng of polyA(+) RNA were ligated to pre-annealed custom RT adaptors (IDT) containing barcodes 78 with T4 DNA concentrated Ligase (NEB-M0202M) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... 250 ng of total RNA was used to synthesize cDNA using LunaScript®RT SuperMix (New England BioLabs Inc, Massachusetts, USA). Quantitative PCR amplification was performed using PerfeCta SYBR Green PCR master mix (QuantaBio ...
-
bioRxiv - Microbiology 2023Quote: ... Region of Cori and ter were quantitatively amplified using the Sybr green-based Luna Universal One-step RT-qPCR kit (New England Biolabs Inc.), without the reverse transcriptase enzyme ...