Labshake search
Citations for New England Biolabs :
2951 - 3000 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Both primers were annealed to a DNA template and ligated by RNA ligase 2 of bacteriophage T4 (New England BioLabs Inc.). White and gray blocks represent RNA and DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% SDS) at 60°C with primers (Table S3) radiolabeled at their 5’-end using T4 Polynucleotide Kinase (NEB, Cat# M0201S) and γ-32P ATP according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression profiles of the genes listed below were analyzed with the specified primers using Luna® Universal qPCR Master Mix (NEB). Quantitative RT-PCR was performed using StepOnePlus (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Microbiology 2019Quote: ... 1 μmol of oligo DNA primer was incubated with 10 μCuries of [γ-32P]ATP and 10 U of T4 PNK (New England Biolabs) in 70 mM Tris-HCl (pH 7.6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Variable regions of transcripts were PCR-amplified for 35 cycles using high-specificity primer pairs designed to minimize cross-hybridization between CaMKII genes (Supplementary table XX) using either Phusion polymerase (NEB #M0530) or KAPA HiFi polymerase (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared with random primers using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, #E7760L) with NEBNext Multiplex Oligos (NEB ...
-
bioRxiv - Systems Biology 2019Quote: ... and C-terminal AD was PCR amplified from pGADCg101 using forward primer AP36 (5’ GAAGGCTTTAATTTGCAAAGCTCGGGATCCGGGCCCCCCCTCGAGATCCGcatctattgaagtaat aataggcgcatg 3’) and reverse primer AP37 (5’ CAACCTTGATTGGAGACTTGACCAAACCTCTGGCGAAGAAGTCCAAAGCTctgaataagccctcgt aatatattttcatg 3’) and cloned into EcoRI (New England Biolabs, NEB) and SalI (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... The single primer linear extension was done with EZ-Tn5 primer3 using Taq DNA polymerase (New England Biolabs, Ipswich, MA, USA). The 50 μl linear PCR extension reaction constituted ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Genetics 2020Quote: ... In vitro transcription template was amplified with T7 promoter sequence containing primer and in vitro transcribed using T7 RNA polymerase (NEB, E2040S). The IVT RNAs were capped using Vaccinia virus capping enzyme (Cellscript ...
-
bioRxiv - Genomics 2020Quote: ... 1 μM of NEBNext Unique Dual Index Primers and 25 μl NEBNext Q5U Master Mix (M0597, New England Biolabs, Ipswich, MA) were added to the DNA and amplified as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µl Forward Stagger Mix (10 µM) and 2 µl Reverse Index Primer (10 µM) specific to each vector backbone and Nuclease-free water (NEB,USA) up to 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... ORF was amplified from MCF10A human mammary cells using specific primers (listed in Table S2) with Q5 High-Fidelity 2X Master Mix (New England BioLabs, # M0492), following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Reverse transcription reactions were performed with 6 μl of purified RNA and random primers using the NEB ProtoScript II First Strand cDNA Synthesis Kit (NEB, E6560S), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and ChCEC6 were amplified using primers listed in Supplementary Table 3 and Phusion® High-Fidelity DNA Polymerase (New England Biolabs), then cloned into pCR8/GW/TOPO (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with primers described in Table S2 according to the Phusion® High-Fidelity DNA polymerase supplier recommendations (New England Biolabs). Genomic DNA sequencing was performed using the 1F_typeIII primers (Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... E1E2 sequence was amplified via PCR from pcDNA E1E2 vector using primers (forward 5’ CGAAGCTTGCATGGGTTGCTCTTTC 3’. and reverse 5’ CAGAATTCCCGCCTCCGC 3’) the product was subsequently digested with HindIII and EcoRI (NEB, USA) and ligated into pEGFP-N1 to create a E1E2-EGFP fusion construct with EGFP at the C-terminal end.
-
bioRxiv - Microbiology 2022Quote: ... 2 µL of 10 mM indexed P5 and P7 primer solutions and 25 µL NEBnext High-Fidelity 2X Master Mix (New England BioLabs: ME541L) were added ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were phosphorylated and ligated together by adding T4 ligation buffer and T4 Polynucleotide kinase (PNK) enzyme (NEB; B0202A and M0201S) and running on a thermocycler under the following conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... were incubated with 25 μL of containing TF or 18S primers and fluorescent Luna® Universal qPCR Master Mix (New England Biolabs), and qRT-PCR was carried out in triplicate for each sample on the CFX Connect real-time System (Bio-Rad Laboratories).
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... DNA fragments were amplified with 15-20 bp of homology regions in primers using Phusion R High Fidelity DNA polymerase (New England Biolabs; NEB) and homology based assemblies were performed using NEBuilder® HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was carried out with a standard oligo-dT primer protocol using the ProtoScript II First Strand cDNA Synthesis Kit (NEB E6560). RNA concentrations were normalized between samples prior to reverse transcription ...
-
bioRxiv - Immunology 2022Quote: ... 100 µl volume) using primers described in Table S3C and Phusion® High-Fidelity DNA Polymerase (New England Biolabs, Beverly, MA). This provides approximately 300X coverage for sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... PCR assays were performed with the strain-specific multiplex primers from (46) and Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs) in 20 µl reactions ...
-
bioRxiv - Microbiology 2022Quote: ... two fragments were amplified from pJG_thrC_dCAS9_gRNA and the new spacer was introduced in the overlap of primers designed for NEBuilder HiFi DNA Assembly (NEB, cat # E2621). For the gRNA used to target tad1 ...
-
bioRxiv - Microbiology 2022Quote: ... pKVS45-tifA ablated ToxN-site was constructed via round-the-horn PCR on pKVS45-tifA using the primer pairs SS-33/34 followed by Gibson Assembly using the 2x HiFi DNA Assembly Master Mix (NEB E2621). TifA codons were recoded using Geneious and ordered as a gene-block fragment from IDT (with 46 of 85 codons recoded with 55 nucleotide changes ...
-
bioRxiv - Microbiology 2022Quote: Libraries cloned in the pYD1 vector were amplified using forward 5’-TTAAGCTTCTGCAGGCTAGTGGTG-3’ and reverse 5’-CACTGTTGTTATCAGATCAGCGGG-3’ primers with Taq DNA Polymerase and ThermoPol Buffer (New England Biolabs Ltd) for 16 cycles of 95°C for 30 sec ...
-
bioRxiv - Physiology 2023Quote: ... primers for separate glnA and gfp fragments were generated using the NEBuilder Assembly Tool (neb.com, New England Biolabs Inc., MA, USA). The fragments carry overlapping segments to one another and with the pUA139 vector ...
-
bioRxiv - Neuroscience 2022Quote: ... and pre-amplified for 14 cycles against a pool of primers (Supplemental Table 3) using PreAmp Grandmaster mix (TATAA Biocenter, Sweden #TA05) before exonuclease I treatment (New England Biolabs #M0293L). Pre-amplified cDNA was diluted at least 5-fold with nuclease-free water and mixed with SsoFast EvaGreen with Low ROX (BioRad #1725211 ...
-
bioRxiv - Molecular Biology 2022Quote: ... One µg of RNA together with oligo(dT) primers were used for the cDNA synthesis using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacture’s protocol.
-
bioRxiv - Developmental Biology 2022Quote: ... Genotyping for maintenance of the dmrt2aumb1 line was done using primers JS36/JS37 or JS137/JS138 and treating the amplicon with enzyme BslI (NEB R0555S) which digests only the wild-type amplicon ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF254, cTF255) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF223, cTF218 - see Supp. Table 2) and 25 uL NEBNext Q5U Master Mix (NEB, M0597) and ran the following thermocycling protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.5 uL each 10 uM forward and reverse primers (cTF256, cTF257) and 25 uL NEBNext Ultra II Q5 Master Mix (NEB, M0544) and ran the following thermocycling protocol ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... citri females using primers listed in Table S8 and cloned into pMAL-c5X expression vector (New England Biolabs, Ipswich, MA, USA) using NcoI/BamHI sites ...
-
bioRxiv - Genetics 2024Quote: ... 400 nM of each of the flanking primers indicated in S2 File (most of them designed using the Primer-BLAST online tool from the NCBI) and 0.1 units/µl of LongAmp Taq DNA polymerase (NEB Cat. # M0323L). Amplification of the genomic locus containing the sgRNA target site was confirmed by analysis of the PCR products on a 1% agarose gel and the presence of desired mutations was confirmed by sequencing the amplicons using the primers indicated in S2 File ...
-
bioRxiv - Genomics 2024Quote: ... gDNA was first amplified with primers JLSPr141–144 and JLSPr165–168+171+172 using Q5 High-Fidelity DNA Polymerase (NEB #M0491) for 20 cycles with an annealing temperature of 65°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The splitGFP plasmid was amplified using primers 53 and 54 to install 3’ stop codon and primers 55 and 56 to install the 5’ stop codon using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... Target cDNA were then amplified using primers that span the trans-splice junction (primers 41/42 for dmd and primers 43/44 for lmna) and predicted mutation with Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 25-cycles ...
-
bioRxiv - Bioengineering 2024Quote: ... either half of the EGFP open reading frame was amplified from pLHA-TR-EF1α-Hipk3-Polio-SplitGFP45 with primers 49 and 50 (first half of EGFP ORF) and primers 51 and 52 (second half of EGFP ORF) using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to manufacturer’s recommendations and using NEBNext® Multiplex Oligos for Illumina® (96 Unique Dual Index Primer Pairs, New England Biolabs). Libraries were quantified using Qubit 3.0 dsDNA HS Assay Kit (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... and P7-index-Read2-EGFP (CAAGCAGAAGACGGCATACGAGATAGGATTCGGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTGgCATGGACGAGCTGTACAAG) (200 nM each) were used as primers with the NEBNext Ultra II Q5 Master Mix (NEB, M0544L). Amplification was performed using the following PCR protocol ...
-
bioRxiv - Microbiology 2023Quote: ... TTP and IFN-λ1 were cloned using primers found in supplementary table 1 and inserted between pCW57-MCS1-2A-MCS2 EcoRI (NEB # R3101S) and BamHI (NEB # R3136S ...
-
bioRxiv - Systems Biology 2023Quote: ... The first round was performed with primer pairs listed in Supplementary Table S7 with 16 cycles using NEBNext High Fidelity Master Mix (NEB, # M0541) for the screens with EpiC and Tiling libraries and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Systems Biology 2023Quote: We amplified the synthesized oligo library using the following primer pair GGCTTTATATATCTTGTGGAAAGGACGAAACACCG (Forward) and CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC (Reverse) with NEBNext High-Fidelity Master Mix (NEB, #M0531) for 10 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...