Labshake search
Citations for New England Biolabs :
251 - 300 of 3826 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A rapid, highly sensitive and open-access SARS-CoV-2 detection assay for laboratory and home testingbioRxiv - Molecular Biology 2021Quote: ... 6 mM MgSO4 (100 mM stock, NEB), 0.32 U/μl NEB Bst 2.0 polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Digest with 6 x loading dye (NEB) was run on a 1 % agarose gel at 100 V for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 6 U of Heparinase I (NEB) was added to the first strand cDNA synthesis mix ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 μl BST LF polymerase (NEB M0275L), and 36 μl DEPC-treated H2O ...
-
bioRxiv - Plant Biology 2024Quote: ... 6 µg of the commercial EngenCas9 (NEB) with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by PNGase A (NEB; pH 6). The released N-glycans were purified using initially a cation exchange material (Dowex AG50 H+ form ...
-
bioRxiv - Bioengineering 2024Quote: ... 6 mM Magnesium Sulfate (MgSO4 – NEB #B1003), 1.4 mM deoxynucleotide (dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... with or without phosphatase addition (0.25 μL of 11 phosphatase in 50 μL reaction volume, New England Biolabs, P0753 or 200 nM purified 6xHis-Calcineurin ...
-
bioRxiv - Biochemistry 2021Quote: ... 11) with 15 cycles of PCR using NEBNext® Q5® Hot Start HiFi PCR Master Mix (NEB), which allowed to add Gap Repair recombination sequences for the cloning in Gal4-AD prey plasmid pP7 ...
-
bioRxiv - Immunology 2020Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... and amplified by PCR for 11 cycles using NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using a PCR Purification Kit (Qiagen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... index groups and Illumina sequencing adapters were added by performing 11 PCR cycles with Phusion DNA Polymerase (NEB). We multiplexed the samples in several index groups (19 and 20 individuals each) ...
-
bioRxiv - Plant Biology 2023Quote: ... IP protocol described in (11) was followed thereafter and Epimark® N6-Methyladenosine Enrichment Kit (New England Biolabs) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... Both 3' and 5' ligations were carried out with degenerate adaptors (each containing 4 random nucleotides) in the presence of 10% Polyethylene Glycol (PEG 8000, NEB) and 0.5 μL of Superasin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Genomics 2019Quote: ... One million nuclei aliquots were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 200 µl of GpC methyltransferase M.CviPI (NEB M0227L) reaction containing 1X GC Reaction Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Molecular Biology 2019Quote: ... with Luna Universal One-Step RT-qPCR reagents (New England Biolabs). 50 ng total RNA and 250 nM primers were added in each reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and one round of rRNA depletion (NEBNext rRNA depletion kit, NEB). After ethanol precipitation ...
-
bioRxiv - Synthetic Biology 2019Quote: ... One mm slices of the Midrange PFG markers (NEB cat. N0342S) were placed into the flanking lanes as size standards ...
-
bioRxiv - Microbiology 2021Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs) was used ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... one set of the replicates were treated with lambda phosphatase (NEB) overnight at 25°C before incubation with the pS1615 antibody (Figure 2 – figure supplement 1B).
-
bioRxiv - Genetics 2022Quote: ... we used the Luna One Step RT-qPCR kit from NEB according to the manufacturer’s instructions at 10μl total volume in 384 well plates ...
-
bioRxiv - Genetics 2022Quote: ... One 20 μl ligation reaction using T4 ligase (New England Biolabs) was carried out using 0.9 ng of the gel-purified insert and 500 ng of the vector ...
-
bioRxiv - Systems Biology 2019Quote: ... and the Luna Universal One-Step RT-qPCR Kit (NEB, E3005E) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... or Luna Universal One-Step RT-qPCR Kit (New England Biolabs). Primer sequences used are described in Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: Centrosomal circularities were evaluated in one-cell embryos ranging from NEB to metaphase that were immunostained with an antibody against SPD-5 ...
-
bioRxiv - Biochemistry 2022Quote: ... by Luna Universal One-Step RT-qPCR Kit (New England BioLabs) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and Luna Universal one-step qRT-PCR kit (New England BioLabs) as previously described (13 ...