Labshake search
Citations for New England Biolabs :
151 - 200 of 3826 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL Murine RNase Inhibitor (New England Biolabs, M0314) was added ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNAs were used as templates for SYBR green-based one-step reverse-transcriptase quantitative PCR (RT-qPCR) using the NEB Luna One-Step RT-qPCR kit (New England Biolabs). All primers were validated by standard curve analysis and had PCR efficiencies ranging from 90-110% ...
-
bioRxiv - Microbiology 2021Quote: ... Virus titer was determined using SYBR-based one step qRT-PCR with Luna Universal One Step qRT-PCR reagent (NEB). QuantStudio 5 (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Immunology 2020Quote: ... We quantified RNA using a one-step RT qPCR reaction with the NEB Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probes (SARS-CoV-2 E_Sarbeco and hamster RPL18 ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA was extracted from heads and thorax+abdomen of one female and one male using the Monarch Total RNA Miniprep Kit (New England, BioLabs). RNA was purified by ethanol precipitation and equal concentration of head and thorax+abdomen tissue was pooled for sequencing ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... One microliter of PNGase F (New England Biolabs) was added and the deglycosylation reaction proceeded during two hours at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... One microliter of PNGase F (New England Biolabs) was added and the deglycosylation reaction proceeded during two hours at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... one colony of T7 Express competent cells (NEB), transformed with a pET-15b plasmid for the expression of microID ...
-
bioRxiv - Microbiology 2022Quote: ... Luna One-Step qRT-PCR (New England Biolabs) using the primers for each specific gene of interest (Table 2) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µl of extracted RNA was used in a TaqMan one-step qRT/PCR assay (Luna® Universal One-Step RT-qPCR Kit, NEB). TaqMan analysis was carried out with primer/probe combination described in Table 1 and analysis performed on the QuantStudio™ 6 Flex System (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... from COLO205 cells was subjected to one-step RT-qPCR analysis using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis and qRT-PCR were performed in a one-pot reaction using Luna® Universal One-Step RT-qPCR Kit (NEB). A QuantStudio Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Cell Biology 2021Quote: ... The tubes were cooled at 42 °C for 10 min before addition of 3 μl of β-agarase (NEB) dissolved in 100 μl MES solution ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Biophysics 2022Quote: ... The DiCas7-11 mutants were prepared by Q5 2X master mix mutagenesis kit (New England Biolabs) using primers listed in Supplementary Table 2 and purified similarly as the wild-type DiCas7-11.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were eluted from beads with 11 μl 1x TE and 1.5 μl USER enzyme (NEB) for 15 min at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 12 h at 4 °C with 10 μg of Factor Xa protease (New England Biolabs, Hitchin, UK) per 1 g of mitochondria ...
-
bioRxiv - Biophysics 2024Quote: ... A 4°C AKTA Pure FPLC system (Cytiva) was prepared with a 10 mL amylose column (NEB #E8021S) and 2 mL/min flow rate ...
-
bioRxiv - Microbiology 2021Quote: ... and ∼ 90 ng was used for one-step RT-qPCR using Luna® Universal one-step RT-qPCR kit (New England BioLabs Inc.) [10 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription and qPCR were performed in a one-step reaction using Luna® Universal One-Step RT-qPCR (NEB, Ipswich MA) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... and the Luna One-Step RT-qPCR Kit (NEB) in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... One microlitre of T4 DNA ligase (NEB, 400,000U/mL) was added to the reaction and incubated at 16 °C to ligate inserts ...