Labshake search
Citations for New England Biolabs :
501 - 550 of 3826 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 3 U of T4 DNA polymerase (NEB), 9 U of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 units of USER enzyme (NEB, Cat.No.M5505) and 40units of recombinant rnase inhibitor was added into elution products and incubated at 37°C for 20min for DNA strand digestion ...
-
bioRxiv - Developmental Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Zoology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Plant Biology 2020Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL CutSmart buffer (New England Biolabs), 20 μL DNA solution (50 ng total DNA ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Pathology 2021Quote: ... 3 µL of DNAse I (NEB, USA) were added ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 μl ThermoPol Buffer (New England Biolabs), 1 μl dNTPs (10 mM) ...
-
bioRxiv - Microbiology 2020Quote: ... consisting of 3 μL DNase I (NEB), 3 μL 10xDNase I Buffer (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Pathology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Genomics 2023Quote: ... 3 µl of Lambda Exonuclease (NEB, #M0262L), and 3 µl of Exonuclease I (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Cancer Biology 2023Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... Then 3 μl USER Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μl of PvuI (NEB, Cat. R3150S) PacI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and AAV9-based rep-cap plasmids incorporating individual heptameric peptides (EC1-10) (pACG2-[EC1-10], pACG2-QuadYF+TV-[EC1-10], and pACG9-[EC1-10]) were generated through site-directed mutagenesis (NEB Q5 site-directed mutagenesis kit ...
-
bioRxiv - Cell Biology 2021Quote: ... Suitable NEXTflex-6 barcodes were ligated using Quick Ligation kit (NEB) before consecutive selection of DNA fragments >100 bp and then >150-200 bp using AMPure XP beads ...
-
bioRxiv - Genomics 2019Quote: ... The 60 μL mix contained 6 μL of TAQ buffer (NEB), 3 μL of 5 μM forward primers mix ...
-
bioRxiv - Systems Biology 2021Quote: ... The samples were mixed with gel loading dye (purple, 6×) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... 6× NEB™ Purple Gel Loading Dye (no SDS) (NEB, B7025S) was added to samples before separation on a 0.8% agarose/TAE gel in 1xTAE at 30V for 22 hours at 4°C.
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adenosine was added to the 3’ end of the DNA fragments using Klenow (3’-5’ exo-) (New England Biolabs). DNA was purified using ratio of 1:1.8 sample to AMPure XP beads ...
-
bioRxiv - Microbiology 2021Quote: ... and a total of 20 μg were ligated with 50 pmol 3′adaptor Linker (5′-rAppCTGTAGGCACCATCAAT–NH2-3′; NEB) via a 16 h incubation at 16°C using 20 U T4 RNA ligase (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single step PCR was performed using a One-Taq™ PCR reaction kit (NEB, USA) with 30 amplification cycles and 2 ng of original circular-DNA extract as the DNA template ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, #E3005L or #E3006E) according to manufacturer’s instructions and then analyzed with QuantStudio Design & Analysis Software v1.5.1 (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: The purified aptamer pool was then amplified by PCR with One Taq DNA polymerase (NEB), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB) and two 21-base primers (HTOP and HBOT ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX384 (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... We used the Luna Universal One-step RT-qPCR kit (E3005S, New England Biolabs, MA) to determine the relative abundance of target mRNA between two samples ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was injected into one-cell state embryos together with Cas9 protein (New England Biolabs). Mutant animals were identified by PCR using the primers ...
-
bioRxiv - Immunology 2021Quote: ... and 60 ng were used for the One Taq RT PCR Kit (New England Biolabs) according to the instructions provided by the manufacturer for mRNA quantification and reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: One microliter of cDNA was amplified by PCR using OneTaq DNA Polymerase (New England Biolabs) with with the following primers for the two putative SIFamide receptor ...
-
bioRxiv - Genetics 2020Quote: ... One aliquot of the digested DNA was subjected to overnight RNase H (NEB cat#M0297) treatment at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... using Luna Universal Probe One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and 16s rRNA transcripts by the Luna Universal One-Step RT-qPCR kit (NEB, E3005), according to the manufacturer’s instructions on an Applied Biosystems 7500 Fast Real-Time PCR System ...
-
bioRxiv - Neuroscience 2022Quote: ... The RT-qPCR was performed using Luna One Step RT-qPCR mix with dUDG (NEB). Amplification using Luna One Step qPCR mix with UDG (NEB ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: One hundred nanograms of the amplicon was incubated with 10U of TelN Protelomerase (NEB, USA) according to the manufacturer’s instructions at 30°C for 30 minutes ...