Labshake search
Citations for New England Biolabs :
2851 - 2900 of 4002 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Twenty microlitre reaction mixtures were prepared using the Luna® Universal qPCR Master Mix kit (New England Biolabs) as follows ...
-
bioRxiv - Genetics 2024Quote: ... pelleted again and then resuspended in 300 µl of cold 1.5X DpnII reaction buffer (NEB cat no. R0543S). Chromatin were denatured by adding 33.5 μL of 1% SDS (Fisher Scientific cat no ...
-
bioRxiv - Microbiology 2024Quote: ... and combined with corresponding gene inserts in Gibson reactions (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs) to allow integration of targeted genes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR reactions were performed utilizing the Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs). Plasmids were sanger-sequenced to confirm the presence of all inserts ...
-
bioRxiv - Cell Biology 2024Quote: ... Library samples were enriched with 11 cycles of PCR amplification in 50uL of total reaction volume (10uL 5x KAPA buffer, 1.5uL 10 mM dNTPs, 0.5uL 10 mM NEB Universal PCR primer ...
-
bioRxiv - Biochemistry 2023Quote: 16.5 nM of linearized template plasmid was added to IVT reactions in RNA polymerase buffer (New England Biolabs) containing 5 mM of each rNTPs ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exonuclease I reaction mixture (1X Exo-I buffer, 1 U/µL Exo-I (New England Biolabs, cat# M0293L)) was pipetted into the device followed by an incubation at 37 °C for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA templates were then degraded by incubating reactions with 5 units of RNase H (M0297, New England Biolabs) and 1 μl RNase cocktail enzyme mix (AM2296 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reverse transcriptase reaction was performed using between 100 ng and 1 μg RNA per sample (NEB, E3010). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... alkaline phosphatase-treated pBOMBL12CRia(e.v.)::L2 for use in a HiFi reaction according to the manufacturer’s instructions (New England Biolabs (NEB); Cambridge ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were conducted using the Q5® High-Fidelity DNA polymerase system (New England BioLabs, Ipswich, MA); 5 μL 5X Q5 Reaction Buffer,0.25 μL Q5 High Fidelity DNA Polymerase ...
-
bioRxiv - Cell Biology 2023Quote: ... was added at 5mM concentration to the transcription reaction along with 0.1 U of inorganic pyrophosphatase YIPP (NEB). In vitro transcription was typically performed for 3 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR reactions were set up using primers specific to either CRISPRi or CRISPRa sequences using Phusion polymerase (NEB) according to the manufacturer’s instructions and using 3 different conditions to minimize amplification bias (HF buffer ...
-
bioRxiv - Microbiology 2022Quote: ... ONT Kit) was ligated to the RNA sample using 3μl NEBNext Quick Ligation Reaction Buffer (New England BioLabs), 0.5μl RNA CS (ONT Kit) ...
-
bioRxiv - Microbiology 2023Quote: RT-LAMP reactions were done using the WarmStart Colorimetric LAMP 2X Master Mix kit (M1800, NEB, Hitchin, UK) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Pooled DNA libraries were amplified in 50 µl reactions with 1x NEBNext High Fidelity PCR Master Mix (NEB) and 12.5 pmol PCR primers containing complementary sequences for adapter-ligated DNA ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions were undertaken using sporocarp extractions using the PHusion High-Fidelity PCR Master Mix (New England Biolabs). Libraries were generated using the TruSeq DNA PCR-Free Prep Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... were amplified by polymerase chain reaction (PCR) with the Phusion High-fidelity DNA Polymerase (New England Biolabs #M0530L), then both amplicons were assembled by Gibson assembly to produce the desired CRISPRoff-mScarletI plasmid.
-
bioRxiv - Genetics 2023Quote: ... Reactions using Vent polymerase were carried out as follows: Vent (exo-) DNA polymerase (New England Biolabs Cat# M0257S) was used according to primer extension experiments described in 21 with the following exceptions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transcription reaction volume was reduced to 10 µl and 0.5 units of thermostable inorganic pyrophosphatase (New England Biolabs) was included in the reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.27 nmol ErCas12a/LbCas12aU protein and 0.45 nmol crRNA were assembled in 1 X Nuclease Reaction Buffer (NEB). The protein and RNA were mixed and incubated for 10 minutes at room temperature and used for transformation of embryogenic C ...
-
bioRxiv - Bioengineering 2023Quote: All qPCR reactions were set up using 7.5 µl of 2 x Luna Universal qPCR master mix (NEB), 0.375 pmol forward primer ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Exonuclease I reaction mixture (1X Exo-I buffer, 1 U/µL Exo-I (New England Biolabs, cat# M0293L)) was pipetted into the device followed by an incubation at 37 °C for 45 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and transformed 1 µL of the reaction mixture into 6 µL of BL21 competent cells (New England Biolabs). After heat shock and recovery in SOC media ...
-
bioRxiv - Biochemistry 2023Quote: ... Polymerase chain reactions (PCRs) were conducted with Q5® High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA), PCR purifications with the Monarch® PCR & DNA cleanup kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... 50pmol of each oligo were mixed in a 25µL reaction and phosphorylated with T4 polynucleotide kinase (M0201S, NEB). Reactions were performed for 30 min at 37°C in 1X T4 DNA ligase buffer (B0202S ...
-
bioRxiv - Microbiology 2023Quote: ... Table S2) were mixed with 25ng of the BamHI-digested pBOMBL12CRia(e.v.)::L2 in a HiFi reaction (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... In the first reaction we made a PCR-fragment with Q5 DNA polymerase (M0491, New England Biolabs, UK) using primers JT403 (CCTGTAGTCTTCTTAATTAAGACGTCAG ...
-
bioRxiv - Cancer Biology 2023Quote: Pellets were resuspended in 99.25 µL micrococcal nuclease reaction buffer (1:10 micrococcal nuclease 10 x buffer (NEB), 1:100 10 mg/mL BSA in distilled water ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a single reaction with 0.75µl each of restriction enzyme BsaI-HF v2 and T4 ligase (both from New England Biolabs) and 1.5 µl each of their buffers (CutSmart Buffer and ligasion buffer including ATP) ...
-
bioRxiv - Systems Biology 2023Quote: ... with 1.5 µg undigested genomic DNA per PCR reaction using Q5 HotStart High Fidelity Polymerase (New England Biolabs). Resulting PCR product from multiple reactions per sample were pooled ...
-
bioRxiv - Immunology 2023Quote: ... TAP reaction was performed in a total volume of 25 µL using 0.12 µL of Q5 polymerase (NEB), 5 µL of GC Enhancer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... three 25 μl PCR reactions were pooled and purified using Monarch PCR & DNA Cleanup Kit (5 μg; NEB), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... were assembled into the Barcoded_AttB_EGFP-Link-PTEN-IRES-mCherry_Bgl2_160407 linearized vector by a Gibson reaction using the Gibson assembly master mix (New England Biolabs) by mixing the oligos with the vector in a 4:1 molar ratio ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Genomics 2023Quote: ... Transposed DNA was gap-filled by addition of 4μL gap-fill mix (3.2 μL Q5 reaction buffer (NEB), 0.07 μL 1M MgCl2 ...
-
bioRxiv - Genomics 2023Quote: ... The end-tagged DNA was oxidized in 15 μL BGT reaction mix (0.3 μL Uridine Diphosphate Glucose (NEB), 1.5 μL NEBuffer 4 (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 4μL gap-filling mix (3.2 μL Q5 reaction buffer (NEB), 0.07 μL 1M MgCl2 ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 15μL gap-fill mix (7 μL Q5 reaction buffer (NEB), 7 μL Q5 high GC enhancer (NEB) ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... Libraries were PCR amplified in 8x 50ul reactions per 10,000 gRNAs (0.5 µl Q5 polymerase (NEB Cat #M0493), 10 µl 5× reaction buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli in vitro transcription were synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and joined using customized low-volume reactions setup by the NEBuilder® HiFi DNA Assembly Master Mix (NEB). The reactions were transformed into the chemically competent HT115 (DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... in a reaction solution containing 50 mM sodium phosphate (pH 7.5) and 1% NP-40 (B2704S, NE BioLabs) for 1 h at 37°C ...
-
A humoral immune response to parasitoid wasps in Drosophila is regulated by JAK/STAT, NF-κB and GATAbioRxiv - Immunology 2024Quote: ... The digested pWallium20 backbone and the amplified PCR fragment were assembled using a HiFi assembly reaction (NEB #E5520), with an incubation time of 1 hour at 50 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Transposed DNA was originally amplified and barcoded in a PCR reaction using NEBnext PCR master mix (NEB, M0544) and 1.25 μM forward and reverse primers originally described in 99 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and all fragment ligation reactions were performed using NEBuilder HiFi DNA Assembly Master Mix (#M5520AA, New England Biolabs).
-
bioRxiv - Molecular Biology 2024Quote: ... Each PCR reaction (25 µl) contained 12.5 µl NEBNext® High-Fidelity PCR Master Mix (New England Biolabs) with 400 nM of each primer and 50 ng template genomic DNA ...