Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Glutathione S Transferase GST Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for one hour at 72°C ...
-
bioRxiv - Genomics 2019Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for one hour at 72°C ...
-
bioRxiv - Immunology 2021Quote: ... Enzymatic assays for PNGase F and Endo S were performed according to manufacturer’s instructions (NEB). The effect of the enzymatic assays was either analyzed by Coomassie staining or immunoblotting.
-
bioRxiv - Physiology 2022Quote: ... DNA block(s) were assembled into the SapI-linearized AAV vector using the NEBuilder (NEB).
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Cell Biology 2023Quote: ... with C-terminal fluorescent tags using seamless cloning (HiFi DNA Assembly Master Mix, New England Biolabs). The pLVX-KRT5-mNG-IRES-Puro construct includes an mNeonGreen (Allele Biotechnology)6 sequence in-frame with the KRT5 sequence separated by a short peptide linker (DPAFLY) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 uL BsmbI-v2 Golden Gate Assembly Kit (NEB E1602L), and 15.03 uL nuclease free H2O ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... Five µl of EcoRI buffer supplemented with 80 µM S-adenosyl methionine (New England Biolabs, Germany) and 2.5 µl BpuEI (5 U/µl ...
-
bioRxiv - Biophysics 2020Quote: ... The primers above were designed with overlaps for Gibson Assembly according to manufacturer’ s specifications (NEB). The three PCR generated fragments were assembled in the presence of pUC18 digested with NdeI and PstI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... together with the Cas9 protein (EnGen® Cas9 NLS, S. pyogenes, M0646M, NEB, Ipswich, MA, USA) was injected into zebrafish embryos at one-cell stage ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μL Luna Universal qPCR Master Mix (New England Biolabs Inc., Bionordika Denmark A/S, Denmark), 1.4 μL of each primer (10 μM) ...
-
bioRxiv - Genetics 2023Quote: ... 0.5 μl of Hia5 MTase (100 U) and 1.5 μl 32 mM S-adenosylmethionine (NEB B9003S) (0.8 mM final concentration ...
-
bioRxiv - Genomics 2019Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq DNA Polymerase (NEB, #M0267) for one hr ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Bioengineering 2020Quote: ... SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (kind gift from Jonathan Abraham lab) ...
-
bioRxiv - Systems Biology 2020Quote: SARS-CoV-2 S was amplified by PCR (Q5 High-Fidelity 2X Master Mix, New England Biolabs) from pUC57-nCoV-S (gift of Jonathan Abraham) ...
-
bioRxiv - Molecular Biology 2019Quote: ... primer annealing at 23°C for 30 s) template DNA was mixed with T7 RNA polymerase(NEB), 50 mM MgCl2 ...
-
bioRxiv - Physiology 2022Quote: ... a fresh aliquot of sgRNA and Cas9 enzyme (Cas9 Nuclease, S. pyogenes, 20 μM; NEB, Ipswich, USA) was used for each day and stored on ice (find respective concentrations in suppl ...
-
bioRxiv - Molecular Biology 2023Quote: ... SssI enzyme in the presence of 160 µM of the methyl donor S- adenosylmethionine (New England BioLabs) for 4 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... and A10 (Supplementary Table 3) were re-folded prior complexation with SpCas9 (Cas9 Nuclease, S. pyogenes; NEB), SpRY ...
-
bioRxiv - Physiology 2023Quote: ... including DNase 1 treatment (Monarch Total RNA Miniprep kit, #T2010, New England Biolabs, USA and QIAGEN RNeasyMini kit, #74104). Purity and quantity of RNA were assessed by determining the optical density (OD ...
-
bioRxiv - Neuroscience 2023Quote: ... column purified and ligated at a 1:1 vector to insert ratio using the QuickLig Kit (NEB #M2200S). The ASCL1 stop codon was subsequently mutated using the QuickChange II-XL site-directed mutagenesis kit (Agilent #200523 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µg RNA was reverse transcribed using LunaScript RT SuperMix Kit (NEB). qPCR was performed using synthesised cDNA ...
-
bioRxiv - Genomics 2020Quote: ... CpG dinucleotides were methylated by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Genomics 2020Quote: ... by incubating 1µg of DNA with S-Adenosyl methionine (SAM) (32µM) with CpG Methyltransferase (M.SssI) (4-25 units) (New England BioLabs) at 37°C for 1h before heating to 65°C for 20mins.
-
bioRxiv - Microbiology 2020Quote: ... followed by 10 cycles of annealing at 54°C for 30 s) using Taq polymerase (New England Biolabs) according to the manufacturer’s instructions and the primers 5-CTTGACATCTCTGAGGCAAC-3 and 5-ATGCAGGGGCAAAGTCATTAG-3 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: The RGB-S reporter was assembled using the isothermal cloning reaction44 Gibson Assembly® Master Mix (NEB inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 500 ng biotinylated λ DNA was incubated at 37°C with 1.6 M S-adenosylmethionine (New England BioLabs) and 20 U CpG methyltransferase M.SssI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... were first formed by mixing 1μg sgRNA/gene with 1μg Cas9 (Cas9 NLS, S. pyogenes, New England Biolabs) at room temperature for 25-30 min ...
-
bioRxiv - Plant Biology 2024Quote: ... but with a blasticidin S-deaminase gene in lieu of SHBLE (Buck, Río Bártulos et al. 2018) introduced by NEB Hi-Fi kit as before ...
-
bioRxiv - Biochemistry 2022Quote: ... EvaGreen DNA dye was replaced with RPA fluorescent probes (DENV2-CAP-probe at 0.12 μM) with 100 U Exonuclease III (NEB), keeping all other reagents same ...
-
bioRxiv - Cell Biology 2021Quote: ... were performed by confocal microscopy in cells previously labelled with the indicated SNAP-Surface fluorescent probe (New England Biolabs) using a Zeiss LSM-780 microscope with a 63X / 1.4 NA oil objective from the FILM Facility ...
-
bioRxiv - Cell Biology 2019Quote: The fluorescent SNAP-tag substrate BG-CF640R was synthesized by amidization reaction of BG-NH2 (New England Biolabs #S9148S) and CF640R-NHS ester (Biotium #92108) ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were pooled by plate and ExonucleaseI (NEB) digestion was performed ...
-
bioRxiv - Immunology 2023Quote: All PD-1 mutants were generated using Q5 site-directed mutagenesis kit (NEB) following the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was first circularized by a T4 RNA Ligase 1 Kit (M0204. NEB) and then purified by TRIzol reagent followed by isopropanol precipitation ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids expressing DSB repair genes were constructed via Gibson assembly of gene fragment(s) and the vector fragment following the manufacturer’s instructions (New England Biolabs).
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM tritiated pSP1 was nicked either using 50 nM Cas12a RNP (WT protein with crRNA 24) at 25°C in Buffer RB for 10 s or using 10 units Nt.BspQI (New England Biolabs) per µg DNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10-20 μg plasmid DNA was incubated with SssI (2.5 U/μg plasmid DNA) in the presence of 160 μM S-adenosylmethionine (SAM; New England Biolabs) for four hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Biophysics 2024Quote: DNA molecules were prepared by digestion of plasmid pSupercos lambda 1,2 (provided by S. Hage, Delft University of Technology, Delft, The Netherlands) with XhoI (New England Biolabs) as described previously(18) ...
-
bioRxiv - Developmental Biology 2024Quote: ... a mix containing 18µM sgRNA and 12µM Cas9 protein (EnGen™ Spy Cas9-NLS S. pyogenes, NEB Cat# M0646T) was incubated for 10 min at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... We first joined sequences for fluorescent protein mCerulean (CFP) and 2A peptide P2A (a ribosomal skip sequence) with Q5 (NEB) fusion PCR and added them to the pWPXL vector with Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...