Labshake search
Citations for New England Biolabs :
151 - 200 of 10000+ citations for Glutathione S Transferase GST Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for Spike G614 variant was generated using the pTwist EF1alpha nCoV-2019 S 2xStrep plasmid and the Q5 site-directed mutagenesis kit (New England BioLabs, Evry, France) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... according to the manufacturer’s protocols and genomic libraries were prepared for Illumina sequencing using the NEBNext Ultra II DNA Library preparation kit (NEB #E7645, E7103) as described in the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2021Quote: ... PARP1 and SET8 GST-fusion and mutant proteins were induced in Escherichia coli ER2566 cells (New England Biolabs
-
bioRxiv - Plant Biology 2023Quote: ... AtPAXXL228E fused to hexa-histidine followed by a GST tag (pGAT3-atpaxxL228E) was expressed in BL21(DE3) (NEB) and purified using a 5 ml GSTrap HP column (Cytiva) ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... accordingly to manufacturer’s instructions and 1 μg of RNA was reverse-transcribed into cDNA using M-MuLV reverse transcriptase (New England Biolabs) and random hexamers ...
-
bioRxiv - Genomics 2020Quote: ... Methylation reactions were performed in a 100 uL reaction with Methylation Reaction buffer (1X CutSmart Buffer,1 mM S-adenosyl-methionine (SAM, New England Biolabs)) and incubated with 2.5 uL EcoGII at 37°C for 30 minutes ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... two guide RNAs and the Cas9 enzyme (S. pyogenes, NEB) were diluted to a final concentration of 20 ng/µl each in injection buffer ...
-
bioRxiv - Microbiology 2020Quote: ... 45 s using the NEBNext Magnesium RNA Fragmentation Module (NEB) followed by RNA purification with the Zymo RNA Clean & Concentrator kit ...
-
bioRxiv - Plant Biology 2022Quote: ... enzyme (MBP-DcATX1C) and S-adenosyl-L-methionine (SAM; NEB) were incubated for 0h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 μl of 32 mM S-adenosylmethionine (SAM; NEB, B9003) and 50 μl of M.CviPI (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Amplified fragments were cloned into pET (His6) and pGEX (GST) based vectors using Gibson cloning method (NEB builder, E5520S). Plasmids used in this study is listed in Table S1.
-
bioRxiv - Biochemistry 2020Quote: pGEX6p2-GST-GβL was cloned from pRK5-HA-GβL into pGEX6p2-GST and was transformed into BL21 (DE3) cells (New England Biolabs) and purified using Glutathione Sepharose beads (45000139 ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Microbiology 2019Quote: ... Typhimurium NCTC 12023 and the vector including the Tet-on system aph tetR PtetA present on p4392 occurred using oligonucleotides as listed in Table S 1 and purified by PCR purification (NEB Monarch). The PCR product encoding for sadBA and the PCR product from vector p4392 were assembled by Gibson assembly according to manufactureŕs protocol (NEB Monarch) ...
-
bioRxiv - Biochemistry 2019Quote: ... GST fusion proteins of the CTD and its mutants CTD-AA and CTD-YA were phosphorylated by Cdc2 kinase (NEB) using 32P-γ-ATP for 30 minutes at 30°C before incubated with immunoprecipitated CoAA or hnRNP M ...
-
bioRxiv - Plant Biology 2023Quote: AtXRCC4 fused to a hexa-histidine followed by a GST tag (pGAT3-atxrcc4) was expressed in BL21(DE3) cells (NEB), The proteins were purified using GST sepharose (Cytiva) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The soluble fraction of the lysate was used for affinity purification on HisPur Cobalt resin (Thermo, Cat#89964), Glutathione Agarose resin (Thermo, Cat#16100) or Amylose Resin (New England Biolabs, E8021), depending of the fusion tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... the commercially available fluorescent ligand SNAP-Cell TMR-Star (New England Biolabs) was used.
-
bioRxiv - Biophysics 2020Quote: ... The fluorescent probe SNAP-Surface Alexa Fluor 546 (#S9132S) was from NEB Biotech ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were quenched with a non-fluorescent bromothenylpteridine (BTP; New England Biolabs) at 2 µM final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... S protein were first incubated with either 1000U/mL PNGase F (NEB) or deactivated PNGase F at 37 °C for 14 h ...
-
bioRxiv - Biochemistry 2020Quote: ... 30 nM dCas9 protein (dCas9 Nuclease, S. pyogenes, M0652, New England Biolabs), 1–4× 104 Beads@oligo ...
-
bioRxiv - Biophysics 2020Quote: ... Deglycosylated trastuzumab was obtained by treatment with Endo S (New England BioLabs) at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 mM Spermidine) supplemented with 0.8 mM S-adenosyl-methionine (NEB B9003S). A negative control was prepared without MTase ...
-
bioRxiv - Genomics 2021Quote: ... into 96-well plate containing 2.5μl of methylase reaction buffer (1 × M.CviPI Reaction buffer (NEB), 2 U M.CviPI (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μL of SYTO-9 dsDNA dye (NEB BioLabs, for LAMP fluorescent curve) was used to monitor the real-time amplification signals ...
-
bioRxiv - Biochemistry 2020Quote: Three microgram of full-length S protein were treated with PNGase F (NEB) for N-glycan release according to the manufacture’s instruction ...
-
bioRxiv - Biochemistry 2021Quote: ... 4% Glycerol and 0.1 mM DTT) with 75 µM S-Adenosylmethionine (SAM, NEB), varying amounts ssRNA and duplex RNA (see above) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 μM Illumina barcode (NEB-kit) to 23 μl of cDNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... containing oligo pool template at 3.33 pg/μL and LAMP Fluorescent Dye (B1700, NEB) at 0.5X was aliquoted across a PCR plate ...
-
bioRxiv - Developmental Biology 2019Quote: ... E7.5) into 96 well PCR plates containing 2.5μl of methylase reaction buffer (1× M.CviPI Reaction buffer (NEB), 2U M.CviPI (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... Proteins were then mixed with Buffer A supplemented with S-adenosyl-methionine (NEB B9003S) containing 1 ug of either naked unmethylated DNA (Plasmid ASP3552 ...
-
bioRxiv - Biochemistry 2022Quote: ... aliquots of S proteins were digested respectively using alpha lytic protease (New England BioLabs), chymotrypsin (Athens Research and Technology) ...
-
bioRxiv - Genomics 2023Quote: ... as described before. Cas9-gRNA complex (6.6 uM S. pyogenes Cas9 Nuclease (NEB, M0386T), 20 uM gRNA ...
-
bioRxiv - Microbiology 2023Quote: ... All S recombinants were constructed via gene fragment Assembly (New England Biolabs, catalog #: E2621S).
-
bioRxiv - Molecular Biology 2024Quote: ... 2.13 mM S-adenosylmethionine) and 50uL of 4,000U/mL M.CviPI GpC methyltransferase (NEB, M0227L). Each methylation reaction was then incubated for at 37 °C shaking at 1000 rpm for 7.5 minutes (unless specified otherwise ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: mRNA was isolated from 6-well plates showing a cell confluency of ∼90% using the Monarch Total RNA Miniprep kit (NEB). siRNA transfection was performed 48 hours prior to RNA isolation using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for 1 hr at 72° ...