Labshake search
Citations for New England Biolabs :
2301 - 2350 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Escherichia coli NEB 5-a (New England Biolabs) was used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... Escherichia coli NEB- 5-alpha (New England Biolabs) was used for cloning and BL21(DE3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 U of Antarctic phosphatase (NEB M0289S) then incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... and 5 μl of quick ligase (NEB M2200L). To release the non-ligated strand of the adaptor ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of 5 µM RA3 adapter (NEB) was added to 5 µL RNA sample ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain NEB 5-alpha (New England Biolabs) (Table S5).
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Physiology 2024Quote: ... 5 μL of PNGaseF (500 U/μL, NEB) with 1x GlycoBuffer 2 (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: RNase H 5 U/µL (NEB, Cat#M0297S)
-
bioRxiv - Developmental Biology 2024Quote: ... and NEB 5-alpha Competent E.coli (NEB C2987H) were used ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 µL of O-Glycosidase (P0733L, NEB) where indicated prior to denaturation/loading on SDS-PAGE gels according to manufacturer protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... and 5′ phosphorylated with T4 Polynucleotide Kinase (NEB). The fragments were mixed with Golden Gate cloning adaptors (5′ adapter ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U/μl exonuclease III (NEB M0206L) and incubating for 15 min at 37°C with agitation (800 rpm 10 s ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli NEB 5-alpha cells (New England Biolabs). Part plasmids and the pET21b(+ ...
-
bioRxiv - Genomics 2024Quote: ... 40 U Antarctic Phosphatase (5 U/µL, NEB), 100 pg [15N5]8oxodG (Cambridge Isotope Laboratories ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 units/μl T3 RNA polymerase (NEB, M0378S) and 1 x RNAPol reaction buffer (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 5 µL TAQ Ligase (NEB, 40 U/µL) and 0.5 µL BST DNA Polymerase FL (NEB ...
-
bioRxiv - Genomics 2024Quote: ... including 5-methyl-dCTP (NEB, Catalog no. N0356S), 5-Carboxy-dCTP (TriLink ...
-
bioRxiv - Biophysics 2024Quote: ... and further nicked with 5 units Nb.BbvCI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2024Quote: ... together with 5 units DNA Pol I (NEB). The mix was incubated for 1 hour at ∼22 °C and cleaned using magnetic beads ...
-
bioRxiv - Biophysics 2024Quote: ... T5 exonuclease (5 units/μg DNA, NEB, M0363) was added to the mixture and incubated at 37 °C for 30 min to digest the remaining nicked DNA ...
-
bioRxiv - Cell Biology 2024Quote: ... coli poly(A) polymerase (5 U/μL) (NEB), with incubation at 37°C for 2 minutes ...
-
bioRxiv - Genetics 2024Quote: ... coli (NEB® 5-alpha Competent E. coli), and successful genetic manipulation was confirmed with sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Chromatin was digested with Microccocal Nuclease (NEB, 37°C, 30 min) in digestion buffer (1M Tris-HC ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 72°C for 30 sec) with Q5 polymerase (NEB Inc.) and appropriate primers (S2 Table).
-
bioRxiv - Developmental Biology 2020Quote: ... for 30□min in 37°C and proteinase K (NEB, P8102S) for 2□h in 37°C and de-crosslinked in 65□°C for 8□h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 72°C for 1 min)) using NEBNext 2x Master Mix (NEB) and Nextera adapters and put on ice ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were digested overnight at 37°C with PNGase F (NEB). After the N-linked glycans were removed ...
-
bioRxiv - Plant Biology 2021Quote: ... Digestions were performed overnight at 37°C with 400U DpnII (NEB). DNA was ligated by incubation at 16°C for 5h in 4 ml volume using 100U of T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... at 37°C overnight and then 100ng GluC (New England BioLabs) was added for another overnight incubation at 25°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Mixes were subsequently digested 1h at 37 °C with DpnI (NEB) and used for electroporation in E ...
-
bioRxiv - Plant Biology 2023Quote: ... Digestions were performed overnight at 37°C with 400U DpnII (NEB). DNA was ligated by incubation in a shaker at 16°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 72°C for 30 sec) with Q5 polymerase (NEB Inc.) and appropriate primers (Supp ...
-
bioRxiv - Developmental Biology 2023Quote: ... 72°C for 1 min) using NEBNext 2x Master Mix (NEB) and Nextera adapters and put on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... for 20 min at 37 °C in RNAse H buffer (NEB). To image and segment whole l.2 Mb tracing loci ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 sec 72°C) with Phusion polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2024Quote: ... for 1hr at 37°C in rCustmart® buffer (NEB #B6004S) following manufacturer recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... for 20 min at 37 °C in RNAse H buffer (NEB) to remove RNA-DNA hybrids ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5-5 μg of column purified DamID material (from above) was end-repaired using the NEBNext End Repair Module (NEB E6050S) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... pCS2+MT-hoxb4a was linearized with NotI and transcribed with SP6 RNA polymerase in the presence of a G(5′)ppp(5′)G RNA cap structure analog (New England BioLabs Inc.). 25 pg of hoxb4a mRNA was injected into one-cell-stage embryos.
-
bioRxiv - Microbiology 2020Quote: ... was PCR amplified with forward primer (5’CGCGGATCCATGGATTTGTTTATGAGAATCTT3’) and reverse primer (5’ AAGGAAAAAAGCGGCCGCCAAAGGCACGCTAGTAGTC3’) by using Phusion High-Fidelity DNA Polymerase (New England Biolabs, M0530L) according to the manufacturer’s protocol and inserted into pcDNA5.1/FRT/TO vector (a kind gift from professor Torben Heick Jensen ...
-
bioRxiv - Genomics 2024Quote: ... We amplified target sequences by PCR using primers designed to span alternatively spliced junctions (FP-5’AGAACGGCAACTCCAATGGC3’ and RP-5’GCCAGTCTCCTTGTCAATGA3’) and Quick load Taq 2X Master mix (#M0271L, NEB, USA) according to the manufacturer’s protocol (28 cycles) ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Biophysics 2022Quote: ... A low-pressure chromatography column connected to a peristaltic pump (5 mL/min flow rate) was prepared with 5 mL amylose resin (NEB #E8021S), followed by equilibration with 50 mL Amylose A Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...