Labshake search
Citations for New England Biolabs :
2101 - 2150 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 6-12 µg of genomic DNA was dephosphorylated with rSAP (NEB), followed by AMPure XP beads purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 μg of pure enzyme (RlmJ/RlmF) or BSA (NEB, Ipswich, MA, USA) as a control [27] ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then treated with 6 U of proteinase K (New England Biolabs) at 37 °C for 30 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Custom oligos flanking the targeted sites were used to amplify genomic DNA from pooled edited cells (Supplementary Table 7) using High-Fidelity 2× Master Mix (New England Biolabs). Indel frequencies were quantified by comparing unedited control and knockout cell lines using Inference of CRISPR Edits (ICE)73.
-
bioRxiv - Bioengineering 2021Quote: ... were PCR-amplified using primers listed in Supplementary Table 7 and cloned into the px601 plasmid using an NEBuilder HiFi DNA assembly kit (NEB). Similarly ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR products were gel-purified and used for a second round of PCR amplification (Q5 NEB master mix, 7 cycles) using custom primers to attach Illumina read sequences ...
-
bioRxiv - Biochemistry 2022Quote: AP-DNA was prepared by incubating 50 μM 7-mer ssDNA [d(GTCUGGA]] with 10 U of uracil DNA glycosylase (UDG, New England Biolabs) in UDG Buffer at 37 °C for 1.5 h ...
-
bioRxiv - Immunology 2022Quote: ... DNA amplifications for the M8 amplicon were also performed similarly except Q5TM polymerase (5.3×10-7 approximate error/bp; New England BioLabs, USA) was utilized ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CDS plus 7–9 bp of untranslated sequence were amplified using High Fidelity Phusion Taq (New England BioLabs, NEB, USA), 3% DMSO vol/vol ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Genomics 2020Quote: ... PCR primers were designed using the Oligo 7 software and PCR was performed using Long-Amp Taq DNA polymerase (New England Biolabs) following the manufactures directions ...
-
bioRxiv - Molecular Biology 2022Quote: ... A total of 50 unit of T4 DNA ligase along with 7 μl of 20 ng/μl of BSA (Biolabs) and 7 μl of 100 mM ATP were added to reach a final volume of 700μl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... We next linearized pattB-DSCP-QF#7-hsp70 (Plasmid #46133)123 using BamHI and NsiI and with Gibson Assembly (NEB) cloned R49E06 promoter in the plasmid.
-
On the causes, consequences, and avoidance of PCR duplicates: towards a theory of library complexitybioRxiv - Molecular Biology 2022Quote: ... Custom P1 adapters containing a 7-bp unique barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample using a T4 ligase (NEB). The 150 robin samples were pooled at equimolar concentrations ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Custom P1 adapters containing unique 7-bp barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample with T4 ligase (New England Biolabs). The DNA from all uniquely barcoded individuals in a library was pooled at equimolar concentration ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Genomics 2023Quote: ... PCR amplification was performed for 7-11 cycles (depending on input DNA concentration) using NEBNext Mulitplex Oligos (New England Biolabs). Indexed sample concentration was quantified using the KAPA Library Quantification Complete Kit (Universal)(Roche) ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...
-
bioRxiv - Neuroscience 2024Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA dissolved in formamide was separated on 8% (w/v) acrylamide/7 M urea/1× TBE gels together with Low Range ssRNA Ladder (N0364S, New England Biolabs), stained with Diamond nucleic acid dye (H1181 ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR-1 (JW45&JW49 or JW48&JW50, Supplementary File 7) was performed with Q5 Hot Start High-Fidelity DNA polymerase (NEB) following manufacturer’s protocol for 25 cycles of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... The colonies were screened for insert using Check1_ins_pSW_for and Check1_ins_pSW_rev primers from Supplementary Data 7 using Phusion polymerase (NEB, Phusion High Fidelity DNA Pol, M0530L) polymerase for inserts >5kb (PCR thermocycling conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: DNA template for in vitro transcription was generated with PCR (primers JW25 and JW15 in Supplementary File 7) using the construct plasmids as a template and Q5 Hot Start High-Fidelity DNA polymerase (NEB). PCR reactions were cleaned up with the Monarch PCR & DNA Cleanup kit (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... Expression plasmids carrying mutated versions of RocS were PCR-amplified from a pt7-7 vector carrying rocS-ΔAH-6His (17) and circularized using Gibson assembly (New England Biolabs). Plasmids were verified by sequencing and stored in the E ...
-
bioRxiv - Genetics 2024Quote: ... the vector was linearized by PCR (Primers 7-8 Table S7) and subsequently we carried out a digestion with DpnI and BamH I (NEB) to degrade the circular template ...
-
bioRxiv - Cell Biology 2024Quote: ... The ligation reaction was performed by incubating the gRNA insert and the pSpCas9(BB)-2A-Puro V2.0 vector at a ratio of 7:1 in the presence of T7 DNA ligase (New England Biolabs, # M0318S) enzyme at 25°C for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: α-Synuclein-A140C was generated from the pT7-7 aSyn WT vector using the Q5 Site-Directed Mutagenesis Kit (NEB, E0554) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of total-RNA samples using the NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB), according to the provided protocol ...
-
bioRxiv - Genetics 2022Quote: ... 5 µL of each reaction was combined with 5 µL Phusion Hot Start Flex 2x Master Mix (NEB) and sequences were extended (95 °C 3 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-preadenylated oligos oHR546-551 were then ligated to the cDNA using 5′ App DNA/RNA ligase (NEB). Amplification and barcoding PCR was then performed with oligos that annealed to the TSA5 and TSA7 sequences and added i5/i7 and P5/P7 sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM DTT) and the 5’-ends were phosphorylated with 25 units of T4 Polynucleotide Kinase (NEB #M0201) for 15 min at 37 °C while shaking in a thermomixer at 1000 rpm for an interval of 15 sec every 3 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Dephosphorylation of the 5’-triphosphate pre-tRNA was done using 5 units QuickCIP (New England Biolabs, cat#M0525S) for 30 minutes at 37°C in 1X rCutSmart Buffer (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR amplification (primers 5’ GCTTGATTTAGGTGACACTATAGAATAC, 5’ ACTCCCGGGTTAAGCGGTACGGTTGTACAGG) was performed using Phusion High Fidelity DNA polymerase (New England Biolabs) using pCS2 TeNT-LC-GFP as a template (a gift from Martin Meyer) ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were digested using 800 U of BamHI (for 5’-5’ loop) or BglII (for junction loop) (NEB) on a shaker overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Molecular Biology 2024Quote: A 2-fold excess of either m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs) or chemically synthesized cap4 hexa-nucleotide (see cap4 synthesis below ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... .5 uL of Phusion polymerase (NEB M0530S), and enough to water to total the reaction volume at 50 uL ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL ExoI (20 U/µL, NEB), 7 µL HinFI (10U/µL ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μL of 5x Phusion buffer (NEB) and 14.25 μL of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 1 μl 5’deadenylase (NEB, M0331) into the 20 μl ligation reaction for incubation with 30 minutes at 30°C and 3 minutes at 65°C to inactivate the enzymes followed by column purification (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Quick T4 Ligase (NEB) in 1X Quick Ligation buffer (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 U Antarctic phosphatase (New England BioLabs) and labeled internal standards were added ([15N2]-cadC 0.04301 pmol ...