Labshake search
Citations for New England Biolabs :
2351 - 2400 of 4333 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The DNA bound to the beads was made ss by λ exonuclease digestion of the strand with 5’ phosphate (5 U/mg DNA, NEB). The reaction was carried out at 370 C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and dominant negative RabD2T91N (RabD2TN) primers (forward primer 5’TGTTGGTAAAAACTGTTGTATGAATAGATATGTTAG3’ reverse primer 5’GAAGACTCTCCTACCATAATAAC3’) using Q5 Site-directed mutagenesis kit (E0554S New England Biolabs, USA) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Whole brains were blocked at RT for 1 h in PBT containing 0.5% BSA and 5% NGS (PBANG) and then incubated in PBANG containing rabbit anti-GFP (1:100; Torry Pines Biolabs, TP401) at 4°C for 2 nights ...
-
bioRxiv - Cell Biology 2022Quote: ... allowing a minimum RNA integrity number (RIN) of 7 (Schroeder et al., 2006) before fragmentation using NEBNext® Magnesium RNA Fragmentation Module (NEB, Ipswich, MA) into short fragments using divalent cations under high temperature ...
-
bioRxiv - Synthetic Biology 2022Quote: In vitro transcription/translation by codon skipping of the short FLAG tag-containing peptides X-Val-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (XV-Flag) where X = 7, 13, 14, or 15 was carried out using the PURExpress® Δ (aa, tRNA) Kit (New England Biolabs, E6840S) based on a previous protocol with slight modifications 16 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting mixtures were loaded on a 6% native polyacrylamide gel with SDS-free loading dye (NEB). The gel was made with TAE-Mg buffer (0.4 M Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cole) containing an N-terminal 6×His-tag using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). The LSD1 constructs were expressed in BL21-CodonPlus (DE3)-RIPL competent E ...
-
bioRxiv - Neuroscience 2024Quote: ... tube 2: 20 µL VLP suspension + 6 µL water + 1 µL Proteinase K (200 µg/mL, NEB), and tube 3 ...
-
bioRxiv - Biophysics 2024Quote: ... then mixed with 0.2 volumes of 6× Agarose Gel Loading Dye (Purple, no SDS, New England Biolabs) and analyzed on a 1% agarose gel containing SYBR Safe ...
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was generated from Venus BBa_J176006 with primers 5’-tctgcacctgaggccaccatggtgagcaagggcgagg and 5’-ggtcacgaattccagcaggaccatgtgatcg via high fidelity PCR followed by spin-column purification (NEB #E0555, Sigma #NA1020). The YFP fragment and mutated pSBtet-GP plasmid were double-digested with Eco81I/ EcoRI (Thermo #FD0374 ...
-
bioRxiv - Microbiology 2022Quote: ... at 16°C overnight or Gibson Assembly Master Mix (New England Biolabs) per manufacturer protocols where stated ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were dephosphorylated using 1μL Lambda phosphatase at 30 °C (NEB; P0753S) for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... the C-terminal domain was removed by digestion with Endoproteinase LysC (NEB) at a 1:800 LysC:substrate ratio by mass for 1-2h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein digestion was achieved by sequential addition of endopeptidase Lys-C (BioLabs) and trypsin (Pierce™ ...
-
bioRxiv - Genomics 2024Quote: ... and dephosphorylated 10 minutes at 37°C using Quick CIP (NEB, M0525). The vectors were then purified with PCR CleanUp kit (Macherey Nagel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Both were ligated at 16°C overnight with T4 DNA ligase (NEB) before XL1 blue transformation ...
-
bioRxiv - Microbiology 2023Quote: ... and M.Fnn25V for two hours at 37 °C in CutSmart buffer (NEB) containing 160 μM S-adenosylmethionine (SAM ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37 °C for 2 hours followed by digestion with PspXI (NEB) in rCutsmart™ Buffer (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... for 1 hour at 25°C with 20% PEG8000 (New England Biolabs). After ligation ...
-
bioRxiv - Immunology 2024Quote: ... miniprepped and digested overnight at 37°C by PvuI (New England Biolabs) twice ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were digested with DpnI (New England Biolabs, 37°C, 1h) and column purified with standard kits (NucleoSpin from Macherey-Nagel or PureLink from Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... 5 mM CaCl2) with MNase (#M0247S, New England Biolabs). The obtained digest (mononucleosomes ...
-
bioRxiv - Microbiology 2020Quote: ... at the 5’ end and NotI (New England Biolabs) at the 3’ end ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added with 5 μl CutSmart Buffer (NEB, B7204) and digested for 2 hours at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), and water to bring to 25 μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli strains: NEB 5-alpha (NEB C2987, not authenticated), BL21-AI (ThermoFisher C607003 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µl of 10U/µl NEB T4 PNK (NEB), 4 µl of 3U/µl NEB T4 DNA polymerase (NEB) ...