Labshake search
Citations for New England Biolabs :
2251 - 2300 of 2483 citations for Mouse D7ERTD443E shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Plasmid assembly was performed by in vitro Gibson Assembly using a HiFi DNA Assembly master mix (New England Biolabs, Ipswich, MA), downscaled to 5 µL reaction volumes ...
-
bioRxiv - Microbiology 2023Quote: ... Mixing the linearised pCRISPR-cBEST plasmid and Del-ptaA with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, USA). The linearised pCRISPR-cBEST plasmid was then bridged by Del-ptaA ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmid length DNA binding experiments were performed with unlabeled circular or linearized M13mp18 single (New England Biolabs, M13mp18 single-stranded DNA) or double-stranded DNA (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... mAmetrine was inserted in place of GFP in both pDawn and pDusk plasmids via PCR and Gibson assembly (NEB HiFi mix). Using the same method ...
-
bioRxiv - Genomics 2022Quote: ... We then ordered an oligo containing 16 Ns with flanking homology arms to the landing pad plasmid (GWLP P1) and used HiFi Assembly (NEB #E2621) to assemble the oligo to the plasmid (50℃ ...
-
bioRxiv - Genomics 2022Quote: ... we digested the respective plasmids with AgeI and EcoRI and ligated them to the backbone with T4 DNA Ligase (NEB #M0202). For ALOXE3 and ALOXE3-mut ...
-
bioRxiv - Genomics 2022Quote: ... signal constructs were amplified by PCR from different plasmids and assembled using the NEBuilder HiFi DNA Assembly Master Mix (HiFi Assembly, NEB #E2621). The BxbI attP site was then added using the Q5 Site-Directed Mutagenesis Kit (Q5 SDM ...
-
bioRxiv - Genomics 2022Quote: ... In vitro methylation of the plasmid with and without the SOCS3 insert was carried out using M.SssI methylase enzyme (NEB, cat.no: M0226S) following standard protocols and successful methylation of the insert was confirmed by digestion with methylation sensitive restriction enzymes AfeI ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2-dKif6 (1-501)-EGFP was generated from the pCS2-dKif6-EGFP plasmid by Gibson assembly (NEB HiFi DNA Assembly Kit) using a GeneArt gene fragment encoding amino acids 1-501 (Thermo Fisher).
-
bioRxiv - Cancer Biology 2022Quote: ... The pLentiCRISPRv2 plasmid was digested for 1 hr at 55°C with 1U per μg of DNA BsmBI-v2 (NEB, R0580), in 5 μl Buffer 3.1 and to a final volume of 50 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... was used to linearize plasmid (10 µg) by incubating at 37 °C for a minimum of 2 hours in 1x CutSmart buffer (NEB, B7204S). Linearized plasmid was purified by extraction with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HRH1 and CHRM3 CRISPR/Cas9 knockout plasmids were constructed from LentiCRISPRv2E plasmids by first phosphorylating and annealing paired sgRNAs with 10X T4 ligation buffer (New England Biolabs, #B0202S) and T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid assembly was performed by in vitro Gibson assembly using a HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich MA), downscaled to 5 µL reaction volume ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... Oligonucleotides were ligated into pSp-Cas9-(BB)-2A-GFP plasmid that had been linearised by digestion with BbsI-HF (NEB R3539) and gel purified (Bioline BIO-52060 ...
-
bioRxiv - Cell Biology 2023Quote: ... APEX2-ATP7B-EGFP and APEX2-mKO2-HA-ATP7A constructs were made on the existing plasmid using NEBuilder HiFi DNA Assembly (NEB #E2621). Mutations on eGFP-ATP7B were prepared following Q5 Site-Directed Mutagenesis Kit (NEB #E0554 ...
-
bioRxiv - Microbiology 2023Quote: ... using a minimum of 20 bp overlapping regions between DNA fragments with custom made kit Plasmid selection and verification after the transformation were checked using the OneTaq® 2X Master Mix with Standard Buffer (NEB). Plasmids were purified using the Qiagen plasmid purification kit according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... The purified products were cloned into pWW plasmid series upstream of sfGFP/mCherry coding sequences37 using NEBuilder® HiFi DNA Assembly (NEB). To perform co-expression experiments ...
-
bioRxiv - Microbiology 2023Quote: ... Four independent mutant plasmid libraries were constructed by mutagenizing mraY in plasmid pNG93 (PlacUV5::mraY) using Taq polymerase with Thermopol buffer (New England Biolabs, M0267L). The forward 5’- ACACTTTATGCTTCCGGCTC-3’ and reverse 5’- ACTGTTGGGAAGGGCGATCAAA-3’ primers were used to amplify mraY from pNG93 ...
-
bioRxiv - Pathology 2023Quote: ... a synthetic gene fragment containing the Spleen-forming focus virus promoter sequence followed by the iRFP670 protein-coding sequence (gBlock; Integrated DNA Technologies, IDT) was assembled with the gel-purified plasmid using the HiFi Assembly Master Mix (NEB, E5520) disrupting nef sequence (Δnef) ...
-
bioRxiv - Systems Biology 2023Quote: ... 3) the wt bZIP sequences by digesting them out of them original plasmids with BamHI-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: Golden Gate assembly part plasmids were made by cloning the parts into the cloning vector pBTK1001 using BsmBI-v2 (New England Biolabs, USA) (Fig S5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pPGK1-mCherry was amplified from the mCherry plasmid described in (Tunney et al. 2018) using uracil-containing primers with Q5U polymerase (New England BioLabs, M0515) and inserted into EasyClone plasmid pCfB2226 by USER cloning upstream of the ADH1 terminator with USER Enzyme Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmid was linearized by PCR and a gene block introducing 9 alanine point mutations was ordered from IDT and cloned into the linearized plasmid by Gibson assembly (NEB E2611L) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inserted using the NEBuilder HiFi DNA Assembly Master Mix into the pKH011 plasmid digested with NcoI-HF (NEB, Cat# R3193S) and XbaI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The gene of the mCherry fluorescent protein was inserted into the pHERD20T plasmid according to the manufacturer’s protocol of NEBuilder® HiFi DNA Assembly kit (New England Biolabs, UK). The resulting plasmid was named pHERDmCh ...
-
bioRxiv - Bioengineering 2023Quote: ... This fragment was inserted into the pAAV plasmid above using the Gibson Assembly® Master Mix (New England Biolabs, Ipswich, MA). This “base” plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... the mCherry-SopF coding sequence was cloned into the pPB Piggybac plasmid (Vectorbuilder) using the NEB HIFI DNA Assembly Kit (NEB, E2621L).
-
bioRxiv - Cancer Biology 2023Quote: ... coding sequence was generated from pSBbi-RN-FGF19 plasmid using site directed mutagenesis (Q5® Site-Directed Mutagenesis – New England BioLabs) using the primers FOR 5’-ATCGGGCCTCTGAGGCCATGCGCGACTCGTCGCCCCTCGTGCACTACGGCTGG-3’ and REV 5’ – CGATGGCCTGACAGGCCTTACTTCTCAAAGCTGGGACTCC– 3’.,
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear DNA constructs encoding Dam or eGFP were amplified via PCR from the plasmids pJV302 (Dam) and pJV170 (eGFP) using NEB’s Q5 HotStart High-Fidelity 2x Master Mix (NEB CN# M0494S). PCR reactions were treated with 1 μL of DPNI for 3 h at 37°C and purified with Zymo Research’s Clean & Concentrator-5 kit according to the manufacturer’s protocol (Zymo CN# D4004).
-
bioRxiv - Systems Biology 2024Quote: ... we directly engineered the pre-barcoded pSL51 and pre-barcoded pSL737 plasmid pools using PCR and HiFi in vitro recombinational assembly (NEB reagents) to generate a construct that should express a single methionine start-codon fused to the Gateway attL2/attR2 “scar” sequence (YPAFLYKVV) ...
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Genetics 2024Quote: ... and were assembled together with a fragment encoding mClover3 followed by a 2A peptide and a pUC plasmid digested with PciI (NEB, #R0655) and SbfI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: All the newly generated plasmids reported in this study were created by Gibson Assembly using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, E2621L) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The plasmids were transcribed in-vitro using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs Cat No. E2050S) to produce RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mutagenesis was carried out in the PTPRH WT-HA plasmid using the Q5 Site-Direct Mutagenesis Kit (New England Biolabs #E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... Flanking sequences and the hygromycin resistance gene were amplified from either genomic DNA or from plasmid pCHYG and using Phusion polymerase (NEB, UK). Fragments were gel purified using QIAquick Gel Extraction Kit (QIAGEN ...
-
bioRxiv - Biochemistry 2024Quote: Active site mutations of PqqU were generated from the plasmid template pBAD24-pqqU using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... or ubi4-REE-act1(till the stop codon) was generated using pcr from plasmids containing these sequences using the following primers and Phusion polymerase (New England Biolabs: M0530S) (F:AATCAACGGCTTCATACCACCTCAGCCAGCCGTGT TATAACTTACCGTTTACCAACTACATTTTTTGTAACG AACCAAAAAACCCTCAAAAGACAAGACCATGCAGA TTTTCGTCAAGAC R ...
-
bioRxiv - Biophysics 2024Quote: The pET-His-KCK-VASP(CCC-SSA) plasmid was transformed into Escherichia coli BL21(DE3) competent cells (NEB, cat. no. C2527). Cells were grown at 30 °C to an optical density (OD ...
-
bioRxiv - Synthetic Biology 2024Quote: All DNA constructs and oligos were designed using either Snapgene (BioMatters Ltd) or Primer3 (Koressaar and Remm 2007) and plasmids were assembled using isothermal HiFi assembly (New England Biolabs (NEB), Ipswitch ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids (pBluescript KS+, pBS hereon) for HiBit-tagged POI mRNA were generated by Gibson Assembly (Gibson Assembly cloning kit, NEB, E5510S) or restriction digest cloning ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Genomics 2022Quote: For each of the two ligation-based protocols used for mouse sperm (Truseq, NEB Next), two replicate libraries for mouse sperm were prepared with the additional condition of an 18 hour ligation at 16°C for the ligation of the 3’ adapter in the attempt to increase ligation efficiency ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA (1 µg) extracted from adult mouse testes was treated with alkaline phosphatase (NEB), de-phosphorylated ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmids from non-motile isolates with straightened flagella were purified using the NEB monarch DNA mini prep kit (NEB, Ipswich, MA) and sequenced by Sanger sequencing using the primers (5-GGCACGAATTCCGAGCTGACGACCGTTCAG-3’ ...