Labshake search
Citations for New England Biolabs :
2201 - 2250 of 2483 citations for Mouse D7ERTD443E shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The seven PCR products were assembled into the pCC1-F567-mNG plasmid that were pre-linearized with NheI and XhoI by using the NEBuilder® HiFi DNA Assembly kit (NEB) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... The 3-part assembly reaction (plasmid-promoter-insert) was performed using the Gibson assembly master mix 2x (New England Biolabs #E2611S), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme digest of 500 ng of plasmid DNA extracted from 190693 and 169757 was performed with PpuMI and XhoI (both New England Biolabs, USA) and immediately run on a 1% agarose gel following incubation for 1 hour at 37°C.
-
bioRxiv - Molecular Biology 2021Quote: Site-directed mutagenesis of the AP-1 binding sites in the distal enhancer reporter plasmids were performed using the Q5® Site-Directed Mutagenesis Kit (New England BioLabs). Primer pairs 5’-CCATAATGTGgggCTATACTAAATTTCATCTTC-3’ and 5’-CTAAATCCACTTAGAAAAAACAATC-3’ ...
-
bioRxiv - Genetics 2020Quote: ... The digestion product was resolved on a 0.7% agarose gel and the plasmid backbone was purified using the Monarch gel purification kit (NEB, Cat# T1020S). The ‘T2A-GFP-WPRE’ sequence was inserted into the digested backbone using the Gibson Assembly kit (SGI ...
-
bioRxiv - Genomics 2021Quote: ... Gibson Assembly was performed using the amplified plasmid backbone and a synthesized DNA fragment “GibsonBC4” according to the manufacturer’s protocol (NEB cat# E2611L). Barcoded plasmid library DNA was purified using the Zymo Clean and Concentrate-5 (Zymo Research cat# D4014 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500bp upstream and 500bp downstream sequence from start codon was inserted in pFA6a-kanMX6 plasmid [60] after the kanMX6 cassette using Gibson assembly cloning (NEB, E2611). FRB tag [23] was then inserted after the start codon by using Gibson assembly cloning and used as template for PCR ...
-
bioRxiv - Microbiology 2022Quote: ... the corresponding ORFs were amplified from the WT strain 536 and cloned into the pUC18 plasmid (ampicillin 100 μg/mL) using BamHI and SphI enzymes (New England Biolabs, USA) (ECP_3022 ...
-
bioRxiv - Biophysics 2022Quote: ... Both insert and vector were digested using the said restriction enzymes and ligated to form a circular plasmid using T4 DNA ligase (NEB, #M0202L). Sequence was verified by sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: All plasmids reported in this work were constructed using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs Cat. #E2621), based on the Gibson assembly method (Gibson et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... the PCR product and the pDRF1-GW plasmid were digested using BamHI-HF and NheI-HF (New England Biolabs, Ipswich, MA) and the PCR product was ligated into the plasmid using T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmids were designed in SnapGene and mutants were generated via Gibson assembly (Gibson Assembly® Cloning Kit from New England Biolabs)57,58 or via QuickChange (Q5® Site-Directed Mutagenesis Kit from New England Biolabs).59 Recombinant expression of motors in E ...
-
bioRxiv - Immunology 2022Quote: Point mutations were introduced through linearizing the plasmid by PCR with primers containing the intended mutations (Supp. Table S1) followed by reverting to circular plasmid with Gibson Assembly Master Mix (M5510A, NEB, USA).
-
bioRxiv - Microbiology 2023Quote: An integration cassette containing two regions of homology flanking a kanamycin-resistance gene was engineered on a pUC backbone plasmid encoding ampicillin resistance using the NEBuilder HiFi DNA Assembly mastermix (NEB E2621L). A counter-selectable marker based on PheS77 was engineered under the constitutive SpeI promoter and cloned into the pUC plasmid (generating pUC-BC ...
-
bioRxiv - Molecular Biology 2022Quote: RLuc-P2A-X-P2A-Fluc plasmids (where X represents a variable sequence) were assembled using NEB Builder HiFi DNA Assembly Cloning Kit (New England Biolabs, #E2621S) by combining the original plasmid digested with HindIII (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... were generated by deletion of the unwanted DNA from the parental plasmid using the Q5 Site-Directed Mutagenesis Kit (NEB BioLabs). The R763G point mutation was introduced into D1-A1 by PCR mutagenesis ...
-
bioRxiv - Neuroscience 2022Quote: ... and was ligated with 500 ng of the purified digested plasmid band and then transformed in NEB stable competent cells (New England BioLabs, C3050H). Successful ligation of the guide was confirmed by Sanger sequencing using a mU6 sequencing primer (Supplementary Table 7).
-
bioRxiv - Physiology 2022Quote: To identify the molecular lesion in the hyds-2 strain a 9KB PCR fragment of the ZK795.1 gene was cloned into the PUC19 plasmid by Gibson assembly (New England Biolabs, Ipswich, MA). The seaEx22 plasmid along with a myo-2:mCherry (PCFJ90 ...
-
bioRxiv - Systems Biology 2024Quote: ... we directly engineered the pre-barcoded pSL51 and pre-barcoded pSL737 plasmid pools using PCR and HiFi in vitro recombinational assembly (NEB reagents) to generate a construct that should express a single methionine start-codon fused to the Gateway attL2/attR2 “scar” sequence (YPAFLYKVV) ...
-
bioRxiv - Microbiology 2024Quote: nfsA and nfsB mutants were constructed by gene inactivation using the pKNOCK suicide plasmid (22) The DNA fragments were amplified with Phusion high-fidelity DNA polymerase (NEB, UK) from E ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Molecular Biology 2024Quote: ... the linear DNA was digested using 28.8 U/μL of plasmid-safe ATP-dependent DNase Exonuclease V (ExoV, RecBCD) (New England Biolabs, MA, USA) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: The pLIC-HA-DHFR-TS (gift from Jeroen Saeij, University of California, Davis) plasmid was treated simultaneously with PacI (NEB #R0547S) and AvrII (NEB #R0174S ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR products were then introduced into pBBR1-MCS2 plasmid at XhoI and HindIII restriction sites (#R0146 and #R0104; New England Biolabs NEB). We then transformed (thermal shock ...
-
bioRxiv - Microbiology 2024Quote: ... A fragment containing the CRISPR array plus the extra BsrG1 restriction site was cut from the synthesized pUC19 by digestion with DraI and BstZ17I enzymes and cloned into the BsaI-linearized pSTU-1 plasmid using the NEBuilder HiFi cloning kit (New England Biolabs, UK). The plasmid sequence was confirmed by sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with NotI and the wc-1 and wc-2 fragments were cloned into the respective plasmids with NEB HiFi DNA assembly mastermix (NEB, US). This resulted in the prey plasmid wc-1-pMB29 and bait plasmid wc-2-pMB28 ...
-
bioRxiv - Biochemistry 2024Quote: ... The DNA fragments for construction of the plasmids were obtained through either high-fidelity amplification using Q5 DNA Polymerase (NEB, USA) or restriction enzyme digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... Primers containing the spacer sequence and homology to the rcRNA plasmid backbone were annealed using Q5® High-Fidelity DNA Polymerase (New England Biolabs) for 35-cycles ...
-
bioRxiv - Cancer Biology 2023Quote: ... coding sequence was generated from pSBbi-RN-FGF19 plasmid using site directed mutagenesis (Q5® Site-Directed Mutagenesis – New England BioLabs) using the primers FOR 5’-ATCGGGCCTCTGAGGCCATGCGCGACTCGTCGCCCCTCGTGCACTACGGCTGG-3’ and REV 5’ – CGATGGCCTGACAGGCCTTACTTCTCAAAGCTGGGACTCC– 3’.,
-
ADEVO: Proof-of-concept of Adenovirus Directed EVOlution by random peptide display on the fiber knobbioRxiv - Bioengineering 2023Quote: ... the whole shuttle plasmid was PCR-amplified with overlapping primers containing the desired insert and recircularised by NEBuilder (New England Biolabs, #E2621L) recombination.
-
bioRxiv - Microbiology 2023Quote: ... All enzymes for DNA amplification (PHUSION® polymerase) and plasmid construction (restriction enzymes, T4-DNA ligase and Quick CIP) were obtained from New England Biolabs (NEB) and used according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers listed in Table S8, then inserted into PHR-mCh- CryWT plasmid (Adgene, 101221) by using NEBuilder HiFi DNA Assembly Cloning Kit (NEB, E5520S). The generated constructs were fully sequenced to confirm the absence of any mutations or stop codons ...
-
bioRxiv - Systems Biology 2023Quote: ... HiFi-Cas9 and LZ3-Cas9 constitutive expression plasmids lentiHiFi-Puro and lentiLZ3-Puro were constructed by the Gibson Assembly Site-Directed Mutagenesis approach (NEB, #E2621) using lentiCas9-Puro as the template ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The purified barcode fragment was then assembled into the cloning backbone plasmid pKI110 by Golden Gate Assembly (66) using BsmBI (NEB #R0580S). We performed two assembly reactions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the plasmids for the Blasticidin and Zeocin resistance marker-based systems were introduced to T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Linear plasmid fragments were generated by PCR and purified by Monarch® PCR and DNA cleanup kit (New England BioLabs®). Ligations were performed with In-Fusion® enzyme at 50°C for 15 minutes (min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we performed the ligation of fragments from module plasmids in the presence of BsaI-HF (New England BioLabs, Ipswich, MA, USA) to generate array plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... Fragments were integrated into the linearized (KpnI/XbaI digested) pRK415 plasmid by NEBuilderR HiFi assembly cloning method (NEB Lab, United States) as described above.
-
bioRxiv - Molecular Biology 2022Quote: PANK3 mutations were made in a gateway compatible pDONR plasmid containing a PANK3 ORF (a gift from the lab of Ben Cravatt) by amplifying the whole plasmid with primers containing the desired mutations and using HiFi DNA Assembly Master Mix (NEB, # E2621) to re-circularize the amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... Phosphorylated primers containing one half of the barcode each at the 5’ ends were used to linearize the pUC-BC plasmid and the resulting amplicon was ligated using T4 DNA Ligase (NEB M2200L). The purified ligation reaction was transformed into NEB-10-Beta competent cells (NEB C3020K ...
-
bioRxiv - Microbiology 2023Quote: Plasmid construction was performed by: PCR amplification of the fragment to insert in the plasmid with Q5® High-Fidelity DNA Polymerase (New England Biolabs), digestion with the appropriate FastDigest restriction enzymes (ThermoFisher) ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 μg of linearized plasmid was used as template in a 10 µL reaction using the HiScribe T7 High Yield RNA Synthesis Kit (NEB # E2040S) with an 8:1 ratio of cap analog to GTP ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid assembly was performed by in vitro Gibson Assembly using a HiFi DNA Assembly master mix (New England Biolabs, Ipswich, MA), downscaled to 5 µL reaction volumes ...
-
bioRxiv - Bioengineering 2023Quote: ... The components of the integration plasmids pTargetF_araA::P103/105/106/101/100-SIDF were sequentially assembled into pTargetF_araA GG using BsaI-HFv2 (NEB, Ipswich, MA, USA) digestion in four steps ...
-
bioRxiv - Neuroscience 2023Quote: ... we introduced a silent mutation into the PAM motif of the sgRNA located within the 3’ homology arm in the donor plasmid by using Q5 Site-Directed Mutagenesis kit (NEB, E0054). The donor plasmid was confirmed with DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... For in vitro transcription plasmids were first linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 500ng of plasmid DNA using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... which were then used to replace the corresponding regions in the wildtype plasmids with NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). All plasmids were fully sequenced ...
-
bioRxiv - Biophysics 2023Quote: ... These plasmids were digested with NotI-HF and XhoI for 2 h at 37°C (R3189, R0146, New England Biolabs, UK) and heat-inactivated for 20 min at 80°C.
-
bioRxiv - Bioengineering 2023Quote: ... a pair of BbsI enzymatic digestion sites were designed to set just after the MAD7 crRNA in the ST7 expression plasmid for the cloning of annealed crRNA oligos by restriction cloning with BbsI and T4 ligase (New England Biolabs, USA). crRNA candidates were designed with CHOPCHOP (Labun et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Ligation of the plasmid with 3Xty insert was carried out via Gibson assembly as per manufacturer’s instructions (New England Biolabs; catalog # M5520AA2) and transfected into NEB5alpha bacteria ...