Labshake search
Citations for New England Biolabs :
2051 - 2100 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The sgRNA sequence was PCR-amplified using high-fidelity Q5 DNA polymerase (NEB, Cat# M0491L) with barcoded primers from genomic DNA for library construction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... High molecular weight (HMW) DNA was released from the agarose blocks using β-agarase (NEB).
-
bioRxiv - Genomics 2023Quote: ... and PCR amplification with Q5® High-Fidelity 2X Master Mix (NEB, catalog no. M0492S). PCR products were confirmed by Sanger sequencing (Genewiz)
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared from purified transposed DNA using NEBNext High-Fidelity PCR MasterMix (NEB, M0541) and Illumina indexing primers ...
-
bioRxiv - Microbiology 2024Quote: ... 72°C: 1’0 min) with a Q5 high fidelity DNA polymerase (New England Biolabs, M0491) and 10 µM forward gene specific primers also containing an additional UMI sequence (8 random nucleotides ...
-
bioRxiv - Molecular Biology 2024Quote: ... The purified DNA was then subjected to amplification using Q5 high-fidelity DNA polymerase (NEB) with a universal i5 primer and a uniquely barcoded i7 primer ...
-
bioRxiv - Genomics 2024Quote: ... The CRISPR-targeted sequences were subsequently amplified using Phusion® High-Fidelity DNA Polymerase (NEB). The primers used for the PCR were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... was followed by PCR amplification using Phusion high-fidelity DNA polymerase (New England Biolabs; M0530S) for 15 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were amplified by PCR using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) with P5 primer (AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNAGGGCGGCAAGATCGCCG TG ...
-
bioRxiv - Cell Biology 2024Quote: ... The editing region was amplified with PCR using Q5 High-Fidelity 2X Master Mix (NEB) followed by purification the PCR product using the QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplicons were obtained using the Q5 high-fidelity DNA polymerase (#M0491; New England Biolabs NEB) and sent for Sanger sequencing to Eurofins Genomics France (Nantes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Amplicons were obtained using the Q5 high-fidelity DNA polymerase (#M0491; New England Biolabs NEB) and sent for Sanger sequencing to Eurofins Genomics France (Nantes ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR mix was prepared for using the Phusion® High-Fidelity DNA Polymerase (NEB) and primer sequences are listed in Table S3 ...
-
bioRxiv - Genomics 2024Quote: ... Endogenous loci were amplified with 1X Q5 High-Fidelity Master Mix (New England Biolabs M0492), 1 M Betaine (MilliporeSigma B0300) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... extracted DNA was amplified using a two-stage Phusion High-fidelity DNA polymerase PCR (NEB). In a three-cycle PCR ...
-
bioRxiv - Genetics 2024Quote: ... PCR amplification was performed with Phusion or Q5 High Fidelity DNA Polymerase (New England Biolabs). Primer sequences are provided in Supplementary Table 4.
-
bioRxiv - Genomics 2024Quote: ... The high-quality HMW DNA molecules were treated with Nb.BssS1 (New England BioLabs, Ipswich, MA) to generate single-strand breaks with sequence-specific motifs (GCTCTTC) ...
-
bioRxiv - Immunology 2024Quote: ... The reaction consisted of 50 µL of NEBNext High Fidelity 2X PCR Master Mix (NEB), 4 µg of genomic DNA ...
-
bioRxiv - Biophysics 2021Quote: ... with 10 µl of folding mixture containing 10 nM M13mp18 scaffold DNA (New England Biolabs), 100 nM unmodified oligonucleotides (Integrated DNA technologies) ...
-
bioRxiv - Genomics 2021Quote: - T4 gene 32 protein (10 mg/mL, NEB or EPFL “homemade” T4g32p, 10 mg/mL). In 96-well plates ...
-
bioRxiv - Biophysics 2020Quote: ... with 10 μl of folding mixture containing 10 nM M13mp18 scaffold DNA (New England Biolabs), 100 nM unmodified oligonucleotides (Integrated DNA technologies ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL of 10 mg/mL BSA and 50 μL of T4 Ligase (NEB M0202L) in a total volume of 1000 μL with nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% SDS) + 10 μL of 10 mg/mL Proteinase K (New England Biolabs, Cat # P8107S). DIP digestion buffer was added to input samples up to 200 μL ...
-
bioRxiv - Genomics 2023Quote: ... Buffer 3.1 and 10 µL of 10 U/µL DpnII restriction enzyme (Cat#R0543T, NEB) were added ...
-
bioRxiv - Microbiology 2024Quote: ... A 10 μL volume of 10-fold DNAse I reaction buffer (NEW ENGLAND BioLabs, catalogue-B0303S), 5 units (2.5 μL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and BSA (10 mg/mL, NEB) were used in all reactions ...
-
bioRxiv - Bioengineering 2020Quote: ... and BSA (10 mg/mL, NEB) as well as the appropriate restriction enzyme ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 units I-CeuI (NEB, R0699) and 5 µl NEB CutSmart buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.08 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.2 µl 10 mM dNTPs (NEB), 0.5 µl DMSO (Fisher Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... 10 units of λ exonuclease (NEB) diluted in 80 μL of Replication Buffer supplemented with 150 nM Sytox Orange and 20 nM RPA were loaded into the flowcell at 70 μL/min.
-
bioRxiv - Genomics 2020Quote: ... 0.5 μl 10 mM dNTPs (NEB), and 5 μl H2O] was also heated to 65°C and quickly cooled to 4°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... BsaI at 10 U / µL (NEB): 12.5 nL) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 10 units of Taq polymerase (NEB), 0.2 mM of regular dNTPs ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 ug of lamda DNA (NEB) or ssDNA M13 primer was labelled using the Ulysis Alexa Fluor 647 nucleic acid labeling kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2019Quote: ... 10 units of DNase I (NEB) was added to all reactions and incubated for 2 minutes to degrade any remaining extracellular DNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 10 units each of DpnI (NEB) and ExoI (NEB ...
-
bioRxiv - Genomics 2020Quote: ... or quick CIP (10 U, NEB), 0.25 µl SUPERase-In (5U)] was added ...
-
bioRxiv - Neuroscience 2020Quote: ... with 10 mM dNTPs (NEB N0447S), VN primers and strand-switching primers (Oxford Nanopore Technologies SQK-DCS109) ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 U/μl DNase I (NEB), and 1 mg/ml papain (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 U of RNase H (NEB) was added ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10% NP-40 (20 μL, NEB), G7 Reaction buffer (20 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... or 10 units of HpaII (NEB) and 2 units of HaeIII (NEB) ...