Labshake search
Citations for New England Biolabs :
2001 - 2050 of 2894 citations for African Swine Fever Virus P72 Protein His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Insertion of hACE2 into pLVX-IRES-puro was conducted by doubl e digestion of XhoI and XbaI (Fermantas) and ligation of T4 ligase (NEB) according to manufact urer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... the mixtures were deproteinized by adding pronase E (4 μg/μl) and 1X purple gel loading dye (New England BioLabs) and incubated at 55°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... These PCRs were performed with the specified primer sets (a, c and e or b, d and f) and Q5 High-Fidelity Polymerase (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by extending a common sgRNA(F+E) sequence with gene-specific crRNA sequence downstream of a T7 promoter by PCR with Phusion polymerase (NEB). PCR product was gel extracted and sgRNA was in vitro transcribed using the MegaShortScript™ T7 Transcription Kit (Invitrogen AM1354 ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... A V5 tag was inserted before the stop codon by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). Afterwards ...
-
bioRxiv - Bioengineering 2020Quote: ... and cloned into pET vector in frame with a C-terminal 6XHis tag by Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix, New England Biolabs). DNA encoding SARS-CoV-2 S RBD (S a.a ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... purified proteins were directly digested by O-glycosidase (P0733, NEB, 4,000 units/µg protein) and α2-3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were also treated with Lambda Protein Phosphatase (Lambda PP, New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 15µl to 25µl of extracted proteins in NuPAGE buffer and 0.5µl protein ladder (BioLabs) were loaded into a Bio-Rad 4-15% Mini-PROTEAN precast polyacrylamide gel ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The Hi-C library for Illumina sequencing was prepared using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... Site-directed mutagenesis was performed to change Arg106 to a histidine (His) using Q5® Site-Directed Mutagenesis Kit (New England Biolabs Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The Hi-C library for Illumina sequencing was prepped using the NEBNext® Ultra™ II DNA library Prep Kit for Illumina (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments and the pABC3-His or pABC3-GFP vector were digested with PacI and NotI restriction enzymes (New England Biolabs, MA, USA). Resultant fragments were then gel-purified using the Monarch DNA Gel extraction kit (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The Hi-C library for Illumina sequencing was prepped by NEBNext Ultra II DNA library Prep Kit for Illumina (NEB Cat# E7645S) according to the manufacturers’ instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Singh et al 2014) were synthesized (Integrated DNA Technologies, Research Triangle Park, NC) and assembled by Hi-Fi assembly (New England Biolabs, Ipswich, MA) into a modified pCAMBIA0380 expression construct (Genbank AF234290.1 ...
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: ... Miip CDS was amplified by PCR and cloned into LV17 (EF-1α-Luciferase-puro) shuttle vector (GenePharma, Shanghai, China) with restriction enzymes Not I and Bam HI (New England Biolabs, Ipswich, MA). For mouse Miip specific knock-down ...
-
bioRxiv - Cell Biology 2020Quote: ... coli CJ236 was picked into 1 ml of 2YT media (Roth, 6676.2) supplemented with M13KO7 helper phage (NEB, N0315) to a final concentration of 1 × 108 pfu/ml and ampicillin (final concentration 100 µg/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Poly(A) polymerase and 5’-ends were converted to mono-phosphates by incubation with RNA 5’ Pyrophosphohydrolase (NEB). Subsequently ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Immunology 2020Quote: ... The ligated plasmids pAF217 and pAF218 were then transformed into NEB® Stable Competent Escherichia coli (High Efficiency) (NEB). Single colonies were selected ...
-
bioRxiv - Microbiology 2020Quote: ... 2μL of the resulting mix was transformed into chemically competent Escherichia coli (High efficiency DH5-alpha, New England Biolabs) according to manufacturer’s instructions and cultured for 16 hours on Luria broth (LB ...
-
bioRxiv - Biophysics 2022Quote: ... coli cells were used for all subcloning steps and for permanent storage of transfected strains (New England Biolabs (NEB) - C2987I) ...
-
bioRxiv - Biophysics 2022Quote: ... coli cells were used for all subcloning steps and for permanent storage of transfected strains (New England Biolabs (NEB) - C2987I) ...
-
bioRxiv - Bioengineering 2023Quote: ... Five µl of the KLD product was used directly to transform chemically-competent Escherichia coli DH5ɑ cells (NEB C2988) according to the manufacturer’s protocol and plated on lysogeny broth (LB ...
-
bioRxiv - Biophysics 2023Quote: ... coli were introduced into the plasmid pRSET-A-FRET (Boersma et al, 2015) via Gibson assembly (New England Biolabs), so the encoded membrane anchor substituted the flexible linker between the mCerulean and mCitrine ...
-
bioRxiv - Molecular Biology 2024Quote: The strains used in this work were T7 express and shuffle T7 express Escherichia coli cells (New England Biolabs). All strains were grown in Luria-Bertani (LB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lambda protein phosphatase (λPP) (NEB) was used to dephosphorylate the purified chromatin ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.9nM Cas9 protein (NEB M0386T) and 14% Phenol Red ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein (20 µM, NEB) was mixed in a 1:1 ratio with the gRNA complex and incubated for 5-10 minutes at room temperate to produce the Cas9:gRNA RNP complex at a final concentration of 10 µM ...
-
bioRxiv - Biochemistry 2022Quote: ... Lambda protein phosphatase (P0753, NEB), AZD8055 (S1555 ...
-
bioRxiv - Immunology 2022Quote: ... Protein G magnetic beads (NEB) were incubated with anti-2A (Novus ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Cas9 protein (NEB M0386T) into the yolk of 1-cell stage embryos in a volume of 1nl ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Cas9 protein (NEB, M0646), and 200 ng/ul of guide RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...