Labshake search
Citations for New England Biolabs :
1901 - 1950 of 10000+ citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... the cross-linked chromatin was ligated using T4 DNA ligase (NEB). The DNA was de-crosslinked ...
-
bioRxiv - Microbiology 2020Quote: ... Linearized plasmids were re-ligated using T4 DNA ligase (NEB M0202). Fragments were amplified using Q5 DNA polymerase (NEB 0491 ...
-
bioRxiv - Immunology 2020Quote: ... for 1 hour and hydroxyl repair with T4 PNK (NEB, M0201S) for another 1 hour ...
-
bioRxiv - Genetics 2020Quote: ... gRNA oligos were phosphorylated and annealed using T4 PNK (NEB, M0201). The cut vector and annealed oligos were ligated overnight at 16°C ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmid was religated with T4 DNA ligase (New England Biolabs) and transformed into TOP10 E ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.2 μL T4 Polynucleotide Kinase (PNK) enzyme (New England BioLabs/M0201S), 1 μL 10X T4 PNK buffer and 2 μL [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The product was blunted by T4 DNA Polymerase (New England Biolabs) and self-ligated with T4 DNA Ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 μL of T4 DNA ligase (New England BioLabs M0202S). The reaction was incubated for 2 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... Annealed oligonucleotides were filled with T4 DNA Polymerase (New England Biolabs) for 20 min at 11 °C ...
-
bioRxiv - Genomics 2022Quote: ... 750 rpm with 40,000 U T4 DNA ligase (New England Biolabs). Then crosslinks were reversed overnight at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... followed by 3′ adaptor ligation using T4 ligase (New England Biolabs). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Fragment ends were repaired using T4 PNK treatment (New England Biolabs) as described by the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by self-ligation using T4 DNA ligase (New England BioLabs) (Figure 1a) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C overnight) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μL NEBNext Quick T4 DNA Ligase (New England Biolabs, UK), and 5 μL of Adapter Mix (ONT ...
-
bioRxiv - Molecular Biology 2022Quote: ... samples were end-repaired by the T4 PNK enzyme (#M0201L, NEB) following manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... some 18S rRNA samples) using truncated T4 RNA ligase K227Q (NEB) to protect the 3’-end of the rRNAs from degradation and to identify the true rRNA 3’-end after sequencing (Table S3) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... All ligations were performed with T4 DNA ligase (New England Biolabs) according to the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 25 µL of 10x T4 DNA Ligase Buffer (NEB #B0202) were mixed in a total volume of 250 µL and incubated overnight at 16°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1.25 µL of 10x T4 DNA Ligation Reaction Buffer (NEB #B0202S), and 0.62 µL of 2 mg/mL BSA (NEB #B9001S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2.5 µL of 10x T4 DNA Ligation Reaction Buffer (NEB #B0202S), and 0.125 µL of 60 mg/mL BSA (NEB #B9001S ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by adapter ligation using T4 DNA Ligase (New England BioLabs). Libraries were amplified with 13 cycles of PCR using single indexed primers.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and ligated species specific 3’ UTR with T4 DNA ligase (NEB). Each of the full length chimeric nos rescue fragments were cloned into pattB vectors using NotI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... the ssDNA overhangs were filled in with T4 DNA polymerase (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 16 U/µl of T4 RNA ligase 2 truncated KQ (NEB), 10°C 20 h ...
-
bioRxiv - Microbiology 2022Quote: ... and 1.5μl T4 DNA Ligase (2M U/ml New England BioLabs) at RT for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... and ligations were performed with T4 DNA ligase (New England Biolabs). All cloning steps were performed in either E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and re-circularized the plasmid using T4 blunt-end ligation (NEB). To clone pMT-Thor-APOBEC-P2A-dsRed (pCR26 ...
-
bioRxiv - Microbiology 2023Quote: ... 25nM of DNA was radiolabeled using T4-Polynucleotide kinase (NEB M0201S) and 0.5μl of ATP(γ-32P ...
-
bioRxiv - Microbiology 2023Quote: ... Here amplicons were incubated with T4 polynucleotide kinase (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fragments were ligated with T4 DNA ligase (New England Biolabs, www.neb.com) into linearized pT7CFE1-cHis digested with complementary restriction enzymes and transformed into 5-alpha Competent E ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNAs were dephospholylated by T4 polynucleotide kinase (New England Biolabs) and ligated with linker for reverse transcription ...
-
bioRxiv - Plant Biology 2023Quote: ... and 1 μL of 400 U T4 DNA Ligase (NEB, M0202S). The following thermocycler program was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... and ligated to the cleaved backbone by T4 DNA ligase (NEB). The ligated products were transformed to E.coli competent cells (DH5α) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The backbone and insert were ligated with T4 DNA Ligase (NEB). Ligation reactions were transformed in with electrocompetent NEB 10-beta cells according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Restriction digestion was followed by ligation using T4 DNA ligase (NEB). The ligated PCR product was transformed into NEB® Stable Competent E ...
-
bioRxiv - Genomics 2023Quote: ... 1 U/μL T4 PNK (New England Biolabs, Cat no M0201S); concentrations refer to a final volume of 50 μL] were added ...
-
bioRxiv - Genomics 2023Quote: ... 10 µL of NEBNext Quick T4 DNA Ligase (New England Biolabs), 5 µL of Adapter mix AMX-F and 3 µL of nuclease-free water ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 μl of SUPERase_In and 1 μl of T4 PNK (NEB)) and incubated at 37 °C for 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Northern probes were labeled with 32P ATP with T4 PNK (NEB) and purified with a G25 column (GE healthcare) ...
-
bioRxiv - Cell Biology 2023Quote: ... restriction enzymes along with 0.25 µl of T4 ligase (M0202S, NEB) in 2.5 µl total reaction volume ...
-
bioRxiv - Genetics 2023Quote: ... and ligated in 20 μL reactions with T4 DNA Ligase (NEB) at 25 °C for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and 1 μL T4 DNA Ligase (400,000 U/mL, NEB, #M0202S). Ligation occurred at 25°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... and ligated together using T4 DNA ligase (New England Biolabs, M0202). The following constructs were created using HiFi assembly (New England Biolabs ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... which were ligated with the backbone using T4-DNA ligase (NEB). Sanger sequencing was performed to validate plasmid assembly and SmaI (NEB ...
-
bioRxiv - Immunology 2023Quote: ... A second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated using T4 ligase (NEB) followed by SPRI clean-up ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 25U T4 polynucleotide kinase (10 U/μL) (New England Biolabs). The radiolabelled RNA was purified by PAGE and resuspended in 40 μL nuclease-free water ...