Labshake search
Citations for New England Biolabs :
1801 - 1850 of 10000+ citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... After ligation at RT for 4 h with T4 ligase (NEB), the nuclei were pelleted ...
-
bioRxiv - Developmental Biology 2021Quote: ... and ligation with Illumina sequencing adapters using T4 DNA ligase (NEB). The resulting mixture was electrophoresed in NuSieve 3:1 agarose (Lonza 50091) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2,000 units of T4 DNA ligase (New England Biolabs, Cat# M0202) was added and incubated at room temperature for 4 hours ...
-
bioRxiv - Genomics 2020Quote: ... with 4 μl (400 U/μl) of T4 DNA ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Genomics 2020Quote: 27 μL of T4 DNA ligase buffer (10X, New England Biolabs),
-
bioRxiv - Genomics 2020Quote: 11 μL T4 DNA ligase (400 U/μL, New England Biolabs),
-
bioRxiv - Biochemistry 2022Quote: ... 10 u/μL T4 DNA ligase (stock 400 u/μL, NEB). No difference in yield was found between the ligation splints ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was labeled with gamma-32P-ATP using T4 PNK (NEB). After washing with PNK buffer ...
-
bioRxiv - Systems Biology 2022Quote: ... and 0.5 μl of T4 polynucleotide kinase (NEB cat. no. M0201S), incubating as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... The probes were labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32P] ATP (Perkin Elmer) ...
-
bioRxiv - Genomics 2020Quote: ... The DNA was re-ligated by T4 DNA ligase (NEB, M0202) at room temperature for 4 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and 3’-end dephosphorylated by 10 U T4-PNK (M0201S, NEB) in the presence of 20 U RNase inhibitor (M0314L ...
-
bioRxiv - Genomics 2019Quote: ... 10 µL T4 RNA ligase 2 truncated (200 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed in 1X T4 Ligase reaction buffer (NEB #B0202S) before being resuspended in 1X ligase (1X T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... total RNA was treated with T4 PNK (New England Biolabs, UK), followed by ligation to 3’-RNA adapter using T4 RNA ligase ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1 µl of T4 DNA ligase buffer 10X (NEB cat. B0202), 0.5 µl of 1 mg mL−1 purified bovine serum albumin (1:20 dilution in dH2O of BSA ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 μL of 400 U/μL T4 DNA Ligase (NEB, M0202), and 660 μL of water ...
-
bioRxiv - Systems Biology 2019Quote: ... The ligation reaction was performed with T4 DNA ligase (NEB, M0202S) joining the linearized NanoBiT vectors (NB MCS1-4 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 1 μL of T4 polynucleotide kinase (New England Biolabs, M0201S) for 45 min at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... We relied on double-stranded ligation using T4 DNA ligase (NEB) with the ligation oligonucleotide added in a 2:1 ratio to the precursor oligo sequence and following the manufacturer’s ligation protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 µL 10x T4 DNA ligase buffer (New England Biolabs (NEB)) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 µL 10x T4 DNA ligase buffer (New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2019Quote: ... 0.025 mM dGTP and 15 U T4 DNA polymerase (NEB # M0203L). The samples were brought up to 50 µL total volume adding ultrapure distilled water ...
-
bioRxiv - Genomics 2019Quote: ... 10 µL of 400 U/µL T4 DNA Ligase (NEB, M0202), and 660 µL of water ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µL of 400 U/µL T4 DNA Ligase (NEB, M0202), and 660 µL of water ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100ul of 10mM ATP and 5ul of T4 ligase (NEB #M0202). The following day ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 µL of T4 RNA ligase II truncated KQ (NEB M0373), 0.5 µL of SUPERaseIN ...
-
bioRxiv - Biochemistry 2021Quote: ... T4 DNA ligase and restriction endonucleases were purchased from NEB (USA). Ligation of DNA fragments was performed using In FusionTM cloning (Takara ...
-
bioRxiv - Genetics 2021Quote: ... end-repair using 0.5 U/µl T4 DNA polymerase (NEB, M0203) and adenylation using 0.5 U/µl Taq DNA polymerase (NEB ...
-
bioRxiv - Genomics 2021Quote: ... and T4 DNA ligase (200 U, New England Biolabs Japan, Tokyo) were mixed ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1.8 µl of T4 RNA ligase (20U final, NEB M0204S), and incubated at room temperature for 90 minutes (min) ...
-
bioRxiv - Cancer Biology 2020Quote: ... oligos were phosphorylated using T4 PNK (New England Biolabs, Ipswich, MA) and annealed in a thermal cycler ...
-
bioRxiv - Biochemistry 2020Quote: ... was used in the cleavage step while T4 Ligase (NEB M0202S) was used for ligation ...
-
bioRxiv - Bioengineering 2021Quote: ... Top and bottom guide oligonucleotides were annealed using T4 PNK (NEB) and ligated into the backbone of eSpCas9_PuroR_GFP plasmid (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: A reaction master mix containing 1X T4 DNA Ligase Buffer (NEB) (2.5 μl/sample volume of 10X T4 DNA Ligase Buffer) ...
-
bioRxiv - Biophysics 2021Quote: ... and ligated with T4 ligase (New England BioLabs, Ipswich, MA, USA).
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of T4 DNA polymerase (NEB M0203, 3U/μl), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... These two oligos were ligated by incubation with T4 ligase (NEB; 1U/μl T4 DNA ligase and 1× T4 DNA ligation buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... ligated to the adaptor using T4 RNA ligase II truncated (NEB) and gel purified ...
-
bioRxiv - Biochemistry 2020Quote: ... and then replaced with 32P using T4 polynucleotide kinase (PNK, NEB) and 32P γ-ATP (Perkin Elmer) ...
-
bioRxiv - Systems Biology 2020Quote: ... A second sequencing linker (AGATCGGAAGAGCACACGTCTG) was ligated via T4 ligase (NEB), followed by clean up with SPRI beads (Beckman-Coulter) ...
-
bioRxiv - Microbiology 2020Quote: ... Digested PCR products were ligated using Quick T4 DNA ligase (NEB) and transformed into E ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 units/µL T4 RNA Ligase 2 (truncated K227Q, NEB). The ligation reaction was incubated for 3 hours at 22 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Igα1 or Igα2 and Igk expression vectors using T4 ligase (NEB). For production of IgG and monomeric IgA ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotides were phosphorylated with T4 polynucleotide kinase (New England Biolabs #M0201L), annealed and ligated (Quick Ligation kit ...
-
bioRxiv - Microbiology 2021Quote: ... followed by ligated to linearized plasmid using T4 DNA ligase (NEB). For site-directed mutagenesis ...
-
bioRxiv - Plant Biology 2021Quote: ... and 200 U of T4 DNA ligase (New England Biolabs, USA) at 22 °C for 2 h ...
-
bioRxiv - Microbiology 2021Quote: ... RNAs were ligated by T4 RNA ligase 1 (New England BioLabs), and purified by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Overnight ligation was performed using 2000U T4 DNA Ligase (NEB, M0202), and then samples were reverse cross-linked with Proteinase K (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sticky ends were ligated using the T4 ligase (New England Biolabs) according to the manufacturer’s instructions ...