Labshake search
Citations for New England Biolabs :
1901 - 1950 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... or colony PCR using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US) if a chromosomal region was targeted ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR reactions were carried out using Q5 High-Fidelity Polymerase (New England Biolabs, Ipswich, MA) per the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2021Quote: ... gBlocks were amplified by PCR using Q5 High-Fidelity DNA Polymerase from NEB (NEB #M0492L) and NEB Tm calculator tool was used to estimate the annealing temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... amplified from cDNA obtained from chick retina using a high-fidelity Phusion DNA polymerase (NEB), cloned into a piggyBac transposon vector pXL-CAG-Zeocin-3xF2A (NotI/AscI sites ...
-
bioRxiv - Microbiology 2021Quote: ... and PCR carried out using Q5® High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Plasmids were transformed and grown in high efficiency DH5α competent cells (New England Biolabs C2987) before extraction by Miniprep (QIAGEN #27104) ...
-
bioRxiv - Cell Biology 2021Quote: ... cloning was utilized to create all constructs and Q5® High Fidelity DNA polymerase (NEB) was used for PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified by PCR using Phusion High Fidelity DNA Polymerase (M0530L; New England Biolabs) using the following primers:
-
bioRxiv - Plant Biology 2021Quote: ... The PCR was performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, USA). After agarose gel electrophoresis the PCR products were extracted from the gel with the QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... in 25 μL containing 0.25 μL Q5 high-fidelity DNA polymerase (New England Biolabs, USA), 1x Q5 5x reaction buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... together with 0.2 μL Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA), 1x Q5 5x reaction buffer and 225 μM dNTP in a total reaction volume of 20 μL ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR was performed using High-Fidelity Phusion PCR Master Mix (NEB, Frankfurt am Main, Germany) (initial denaturation (98 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 25 μl of NEBNext High Fidelity PCR Master 2X Mix (New Englarnd Biolabs, M0541L). The primer sequences and their description ...
-
bioRxiv - Microbiology 2021Quote: ... All PCR steps were performed with Q5® High-Fidelity DNA Polymerase (New England Biolabs) and primers provided by IDT (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The DNA segments were PCR amplified (Phusion High-Fidelity PCR Master Mix, NEB, UK, #M0531) and fused with Gibson recombination cloning method (Gibson Assembly Master Mix ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Enzyme digestions were performed using high-fidelity restriction enzymes purchased from New England Biolabs (NEB). DNA ligations were performed using Promega T4 ligase ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genotyping PCRs were carried out using Q5 High-Fidelity DNA polymerase (New England Biolabs, #M0491) with an annealing temperature of 65°C ...
-
bioRxiv - Genomics 2022Quote: ... in a 25 μl reaction with Phusion® High-Fidelity DNA Polymerase (New England Biolabs) in high GC content buffer with DMSO according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasmids were used to amplify the UTRs with Phusion High-Fidelity DNA polymerase (NEB) using corresponding primers carrying SfiI and NheI restriction sites to allow the inserts between SV40 promoter and the reading frame of hRluc ...
-
bioRxiv - Biochemistry 2022Quote: ... The amplified DNA fragment by high-fidelity DNA polymerase (New England BioLabs, Beverly, MA, USA) was purified using a PCR Purification Kit (QIAGEN Inc. ...
-
bioRxiv - Genomics 2022Quote: ... the PCUP1-Sup35N-Aß42 plasmid was linearised by PCR (Q5 high-fidelity DNA polymerase, NEB) with primers that remove the WT Aß42 sequence (primers MS_03-04 ...
-
bioRxiv - Immunology 2022Quote: ... VP2 and VP3 with high-fidelity Phusion HiFi PCR Master Mix (NEB, Ipswich, MA, USA) using specific primers (S6 Table) ...
-
bioRxiv - Genetics 2022Quote: ... All PCRs were performed using a high-fidelity DNA polymerase (Phusion, New England Biolabs, F530S) and constructs generated by PCR were sequence verified by Sanger sequencing ...
-
bioRxiv - Genomics 2022Quote: ... and Phusion® High-Fidelity PCR Master Mix with HF buffer (New England Biolabs Inc). The amplification was performed in 50 μL PCR reactions that contained:
-
bioRxiv - Cell Biology 2022Quote: ... RAD18 knockout positive cells were confirmed with PCR using Q5 High Fidelity Master Mix (NEB), sanger sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... Obtained cDNA was linearly amplified by overnight IVT (HighScribe T7 High Yield RNA synthesis, NEB) at 37°C under T7 promoter ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using Q5© Hot Start high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNase I (6xHis) or refolded RNase I-ACE2NTD (6xHis) in a high salt buffer (NEB buffer 3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... All reactions were performed with Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) following the manufacture’s recommended reaction setup and cycling conditions ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... using the high-fidelity Master mix Q5 (cat. n° M0492S, NEB, New England Biolabs, USA), and the primers NDV-3LS1-2020-F1 (5’-GATCATGTCACGCCCAATGC-3’ ...
-
bioRxiv - Immunology 2020Quote: ... Each PCR reaction was performed using Q5 Hot Start High Fidelity 2X Master Mix (NEB). For the first round of PCR ...
-
bioRxiv - Microbiology 2021Quote: ... DENV variants were generated by site-directed mutagenesis using Q5 High-fidelity DNA polymerase (NEB) followed by DENV reverse genetics (see below) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and all PCRs were carried out using Q5 High-Fidelity DNA polymerase (New England Biolabs). All DNA fragments were purified from agarose gel (Monarch DNA Gel Extraction kit ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR products were produced with the Q5 High-Fidelity 2X Master Mix (New England Biolabs). All inserts were verified by sequencing.
-
bioRxiv - Immunology 2020Quote: ... Each 50 μL PCR reaction contained Q5 High-Fidelity DNA polymerase and buffer (NEB #M0491), 15ng of lentiCRISPRv2-Brie ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 0.5 μl Q5® Hot Start High-Fidelity DNA Polymerase (New England Biolabs M0493) in a total volume of 50 μl ...
-
bioRxiv - Biophysics 2021Quote: ... and 39x parS were produced by PCR using a high-fidelity polymerase (Phusion Polymerase, NEB) (see Table S1 for primer sequences) ...
-
bioRxiv - Neuroscience 2020Quote: ... 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S), and 5 µL of the Illumina PCR Primer Cocktail (PPC ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments were PCR amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs) or Taq DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... Each PCR#2 reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of a unique Nuc PCR#2 Fwd Primer (10 µM) ...
-
bioRxiv - Genomics 2022Quote: ... Each “PCR#1” reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of Nuc PCR#1 Fwd Primer (10 µM) ...
-
bioRxiv - Genetics 2022Quote: ... The fragments were fused using polymerase Phusion high-fidelity DNA Polymerase (M0530S, NEB, Ipswich, Massachusetts) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were produced with the Q5 High-Fidelity 2x Master Mix (New England Biolabs). Some fragments were ordered as gBlocks at IDT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 12.5 µl of Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA), 1.25 µl each of 10 µM forward and reverse primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... and PCR was amplified with high-fidelity 2X PCR Master Mix (New England Biolabs M0541). One-third of the maximum fluorescent intensity was used to determine the additional cycles ...
-
bioRxiv - Microbiology 2019Quote: ... 50 ng DNA was used for PCR-amplification with Q5 High-Fidelity DNA Polymerase (NEB) targeting to the V3-V4 region of bacterial 16S rRNA gene ...
-
bioRxiv - Genomics 2020Quote: ... the linker for reverse primers: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG using Q5 Hot Start High Fidelity DNA polymerase (NEB) and sequenced by using a NextSeq500 Instrument (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... and amplified by PCR using Phusion High-Fidelity PCR Master Mix with HF Buffer (NEB) to produce sub-pools for Gibson assembly (NEB) ...