Labshake search
Citations for New England Biolabs :
1751 - 1800 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Amplification of DNA segments for cloning used Q5® high-fidelity DNA polymerase (NEB) whereas diagnostic PCR used standard Taq DNA polymerase (NEB).
-
bioRxiv - Plant Biology 2023Quote: ... Fragments were isolated by PCR amplification using Phusion® High-Fidelity DNA Polymerase (NEB) from Col-0 genomic DNA/cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... all PCRs were performed using Q5 High Fidelity DNA polymerase (M0419; New England Biolabs). A plasmid containing human APOE3-TurboGFP was purchased from Origene (Cat# RG200395) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Exon 3 amplified using Q5® High-Fidelity DNA Polymerase (New England Biolabs). The following primers were used ...
-
bioRxiv - Biochemistry 2023Quote: All cloning was performed using the Phusion High-Fidelity DNA polymerase (New England Biolabs) and primers from IDT or Sigma Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... After PCR-amplification using Q5 High-Fidelity 2X Mastermix (#M0492, New England Biolabs Inc.) gel-purified DNA fragments were assembled using RecA recombinase (#M0249 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High-Fidelity DNA polymerase from New England Biolabs (NEB). Genes were either synthesized as bacterial codon-optimized gBlocks fragments (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... Cloning PCRs were performed using Phusion High Fidelity DNA polymerase (M0530L, New England BioLabs) and then validated by Sanger sequencing ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were constructed with Q5 High-fidelity DNA polymerase (New England BioLabs Inc., NEB) and the Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Systems Biology 2023Quote: ... Plasmids were constructed with Q5 High-fidelity DNA polymerase (New England BioLabs Inc., NEB) and the Gibson Assembly Master Mix (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated using the NEB High-Fidelity 2x Mix (New England Biolabs M0541S), PCR amplified for 11 cycles and cleaned up using SparQ PureMag beads (QuantaBio 95196- 060) ...
-
bioRxiv - Evolutionary Biology 2023Quote: AAGCTTGTCGACGGAGCTCGGCCAATCGAAACGAGTTCTGTGT) using Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich USA, cat. #M0530S). The vector pET-23b_RGS_6xHis_Go (Lin ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR reactions were performed utilizing the Phusion High-Fidelity PCR Master Mix (NEB, M0531L) to prevent any mutations ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All PCR amplifications for plasmid construction were performed using Q5 High-Fidelity Polymerase (NEB). All plasmids were sequence verified through Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was PCR-amplified using Q5 High-Fidelity 2x Master Mix (NEB M0492) for 20 cycles ...
-
Engineered autocrine signaling eliminates muscle cell FGF2 requirements for cultured meat productionbioRxiv - Bioengineering 2023Quote: ... This involved amplification with Q5 high-fidelity DNA polymerase (NEB #M0494S, Ipswich, MA, USA), DpnI digestion (NEB #R0176S) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μL template DNA and 0.4 units of Phusion High-Fidelity DNA Polymerase (NEB) (primer sequences provided in Table S3) ...
-
bioRxiv - Microbiology 2023Quote: DNA was amplified by Q5® High-Fidelity 2X Master Mix (New England Biolabs) in a 25 μl reaction ...
-
bioRxiv - Genomics 2023Quote: ... 0.02 U/µL Q5 High-Fidelity DNA Polymerase (New England Biolabs, Cat. No M0491); concentrations refer to a final volume of 50 μL] ...
-
bioRxiv - Immunology 2023Quote: ... tagmented DNA was amplified using NEBNext High-Fidelity PCR Master Mix (New England BioLabs) with the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was achieved by using Q5 High-Fidelity DNA Polymerase (NEB, Ipswich, MA). Exo I (NEB ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... DNA library was then amplified using Q5 High-Fidelity DNA Polymerase (New England BioLabs) in four 25 µl PCR reaction according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... After a 30 cycles PCR reaction with Q5 hot-start high-fidelity polymerase (NEB) following recommended vendor protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... The target sites were amplified using Phusion High-Fidelity DNA Polymerase (New England Biolabs) with target-specific primer pairs and the Illumina TruSeq HT dual index adaptor primer (Supplementary Table 3) ...
-
bioRxiv - Bioengineering 2022Quote: ... and a high-fidelity polymerase (Phusion) purchased from New England Biolabs (NEB, Ipswich, MA). 10 μL PCR reactions were set-up using 2 μL 5x HF Buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The PCRs were performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Phusion High-Fidelity PCR Master Mix with HF Buffer (New England Biolabs catalog # M0531), and/or LongAmp® Hot Start Taq DNA Polymerase with Expand HF Buffer (Roche catalog # 05917131103 ...
-
bioRxiv - Genomics 2022Quote: ... 25 μl of NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S), 2.5 μL each of Nextera i5 and i7 indexed amplification primers (Nextera Index Kit ...
-
bioRxiv - Genetics 2022Quote: ... blunt-end PCR products were generated using Phusion High Fidelity DNA Polymerase (NEB M0530S) and forward primers were designed including 5’-CACC-3’ on the 5’ end for directional cloning and then ligated into MultiSite Gateway™-compatible pME entry vectors using pENTR/D-TOPO (Invitrogen K240020) ...
-
bioRxiv - Genetics 2023Quote: ... 5% DMSO and 1× NEBNext High-Fidelity PCR master mix (New England BioLabs, M0541L) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... PCR reactions were performed with Phusion High-Fidelity PCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Restriction reactions were performed using High-Fidelity Restriction enzymes from New England Biolabs (NEB), by incubating 2 μg of DNA with 2U of each enzyme in the presence of 10X NEB CutSmart buffer ...
-
bioRxiv - Microbiology 2023Quote: The desired inserts were amplified by PCR using Q5 high-fidelity DNA polymerase (NEB) with the high-GC buffer as per the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using Phusion High-Fidelity PCR Master Mix (New English Biolabs, England). PCR products were quantified using 2% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR fragments were generated using Phusion High-Fidelity DNA polymerase (New England Biolabs). The recombinant plasmids were assembled by T4 ligase or Gibson assembly with enzymes/reagents from New England Biolabs (35) ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by PCR amplification using Q5 High-Fidelity DNA polymerase (New England Biolabs, #M0491) and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the Phusion high-fidelity DNA polymerase (New England Biolabs, Cat. No. M0530L). We sequence-verified all constructs by whole plasmid sequencing (SNPsaurus LLC) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR reactions contained 1X Phusion High-Fidelity PCR Master Mix (New England BioLabs Inc.), 0.5 μM primers (forward ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCRs were run with the high-fidelity Q5 DNA polymerase (New England Biolabs). The PCR products (pICOt and pICOt2 ...
-
bioRxiv - Immunology 2024Quote: ... and PCR amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs). Following purification with the PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR amplification of the library region was performed with Q5 High Fidelity Polymerase (NEB) using primers containing Illumina partial adapters ...
-
bioRxiv - Biochemistry 2024Quote: ... was used for high-fidelity PCR and the 2X HiFi Gibson Assembly Mix (NEB) was used for amplicon assembly ...
-
bioRxiv - Microbiology 2023Quote: ... high fidelity Phusion and Q5 DNA polymerases were provided by New England Biolabs (NEB). Restriction digests were carried out in the recommended restriction buffers at the appropriate temperatures ...
-
bioRxiv - Microbiology 2023Quote: ... The variable sgRNA sequences were amplified by nested PCR (Q5 High-Fidelity Polymerase, NEB), the first round of PCR amplifying all sgRNA insertions ...
-
bioRxiv - Molecular Biology 2023Quote: SPPiDDR1 flanking sequences were amplified by PCR with a high-fidelity Q5 polymerase (NEB) and primers combining recombination attB sites and the extremity of sequence ...
-
bioRxiv - Molecular Biology 2023Quote: ... Illumina sequencing adapters were added with Phusion High-Fidelity DNA Polymerase (NEB; seven cycles) and purified by gel extraction ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNA inserts were amplified with NEBNext High-Fidelity 2X PCR Master Mix (NEB M0541L). Samples were then pooled in equimolar concentrations ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... and 0.5 µL Phusion High Fidelity DNA polymerase in 1x PCR buffer (NEB #B0518S) in a total volume of 50 μL.
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using NEBNext® High-Fidelity 2X PCR Master Mix (NEB; M0541S). The purified PCR products were separated by a 4-20% TBE gel (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... TCSs were amplified by PCR using Q5 High-Fidelity DNA polymerase (New England Biolabs), and amplified PCR fragments were purified by column purification using the Monarch PCR Cleanup Kit (New England Biolabs ...