Labshake search
Citations for New England Biolabs :
1701 - 1750 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... was amplified by PCR (Phusion High-Fidelity PCR Master Mix, NEB, Hitchin, Hertfordshire, UK) using specific oligonucleotide primers (5’-TCGCTACTGTTTCTCTCGCA-3’ and 5’-AAAGGCGTCAACAACTGCTT-3’) ...
-
bioRxiv - Neuroscience 2020Quote: ... SaCas9 was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) using primers CATCGACTACGAGACACGGG and TTGTGCACGCCTCTTCTCTT ...
-
bioRxiv - Cell Biology 2021Quote: ... all sgRNAs were amplified using Phusion Flash High-Fidelity PCR Master Mix (NEB, M0531L) with the primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... Q5 Hot Start High-Fidelity DNA Polymerase (M0493L, New England BioLabs, Ipswich, MA, USA) was used to amplify the templates for in vitro transcription ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCRs were performed using either: (i) the Q5 High-Fidelity 2x Master Mix (NEB), followed by DpnI (NEB ...
-
bioRxiv - Genetics 2021Quote: ... All PCR reactions were performed using Q5 High-Fidelity DNA polymerase (New England Biolabs).
-
bioRxiv - Genomics 2020Quote: ... and RT-PCR was performed with Phusion High Fidelity DNA polymerase master mix (NEB) each with the manufacturer recommended PCR thermal cycles ...
-
bioRxiv - Immunology 2020Quote: ... The PCR assays using NEB enzyme Q5® Hot Start High-Fidelity (NEB, M0491) with the following thermocycling conditions ...
-
bioRxiv - Microbiology 2020Quote: ... All knockout constructs were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) except the second step of joint PCR using Taq enzyme (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were generated using a high fidelity DNA polymerase (Q5 Taq, New England Biolabs) on 20 ng of template DNA employing an initial denaturation of 30 seconds at 95 °C ...
-
bioRxiv - Immunology 2021Quote: ... Two rounds of PCR were performed using Q5 High-Fidelity 2X Master Mix (NEB). For the first round of PCR ...
-
bioRxiv - Immunology 2020Quote: ... Second-strand cDNA synthesis was performed using Phusion® High-Fidelity DNA Polymerase (NEB) and six IgH variable region primers containing 10 or 12 nucleotide UMIs with the following cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: ... using NEBuilder High Fidelity (HiFi) DNA Assembly Master Mix (New England Biolabs, Ipswich, MA) via Gibson Assembly Protocol (68) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The library was amplified using NEBNext High-Fidelity 2X PCR Master Mix (NEB; M0541S) and cleaned using SPRI-beads with left-side size selection protocol ...
-
bioRxiv - Immunology 2020Quote: ... High-fidelity PCR amplification of coding sequences using Q5 DNA polymerase (NEB, Ipswich, MA) was performed for regions encoding the N-terminal domain (NTD ...
-
bioRxiv - Immunology 2021Quote: ... Second PCR reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB) with the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: Phage DNA was PCR-amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) in two rounds to produce Illumina libraries containing adaptor sequences and barcodes for multiplexing ...
-
bioRxiv - Microbiology 2021Quote: ... Each PCR included 12.5 μL Q5 High Fidelity 2x Master Mix (New England Biolabs), 3.6 μL of either pool 1 or pool 2 10μM primer master mix (final concentration of each primer was ~10-11pM) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was amplified in two rounds of PCR using Q5 high-fidelity polymerase (NEB). Adapters necessary for sequencing on the Illumina platform were introduced with the KAPA HyperPrep kit (Roche) ...
-
bioRxiv - Genomics 2021Quote: ... The cDNA was enriched using Q5 high-fidelity DNA polymerase (Cat #: M0492; NEB, USA) and ARTIC v3 primers (Integrated DNA Technologies (ITD) ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR was performed with Phusion® high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were generated using Q5 Hot Start High-fidelity system (New England Biolabs). Plasmids encoding IPTG-inducible sdsR or spf (Spot 42 ...
-
bioRxiv - Genomics 2022Quote: ... then 4 μl of Q5 High-Fidelity 2X Master Mix (NEB, cat. no. M0541L) was added to each well ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR fragments were amplified using Q5 High-Fidelity 2x Master Mix (New England Biolabs). The primers (IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was carried out with Q5 High-Fidelity 2X Master Mix (New England BioLabs) using the conditions recommended by the manufacturer for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... A standard PCR protocol with Phusion® High Fidelity DNA polymerase (New England Biolabs) and primer-specific annealing temperatures was used for the DNA amplification ...
-
bioRxiv - Bioengineering 2022Quote: ... the previously tagmented ATAC-DNA was amplified using Q5 High-Fidelity 2X Mastermix (NEB) with universal i5 and indexed i7 adapters ...
-
bioRxiv - Developmental Biology 2022Quote: ... with SP6 and T3 primers and Phusion High Fidelity DNA polymerase (New England, BioLabs). The purified product was used as a template for the transcription reaction using the mMessage mMachine SP6 RNA transcription kit (AM1340 ...
-
bioRxiv - Developmental Biology 2022Quote: ... were PCR-amplified with Q5® high-fidelity DNA polymerase (New England BioLabs, USA) and cloned in the BiFC vectors pSAT1-nEYFP-N1 (N-terminal fragment ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using Q5® high-fidelity DNA polymerase (New England BioLabs, USA), following the manufacturer’s protocol in a final volume of 12.5 μL ...
-
bioRxiv - Genomics 2022Quote: ... and was amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs Cat M0491S) to generate 800 bp TOP2A homology arms ...
-
bioRxiv - Genetics 2022Quote: ... 30µL of Phusion High Fidelity 2x Master Mix (New England Biolabs, Ipswich MA, USA), 3µL of 10 µM each of P1 and P2 primers (Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) using manufacturer-recommended cycling conditions with a 30 second denaturation cycle to ensure full denaturation of genomic DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmids were constructed by using Q5 High-Fidelity DNA polymerase (New England Biolabs) to produce amplicons and ligating amplicons to PCR amplified vectors using Golden Gate DNA assembly.59 The broad range RSF1010 backbone was used for all plasmids and was given generously by Shyam Bhakta.60 All plasmid sequences were verified with Sanger sequencing.
-
bioRxiv - Synthetic Biology 2022Quote: Q5 High Fidelity 2X Master Mix (New England Biolabs GmbH [NEB], Germany, No. M0492S) was used to perform DNA amplification ...
-
bioRxiv - Plant Biology 2022Quote: ... Sequences were amplified with Q5 or Phusion high-fidelity DNA polymerase (New England Biolabs) from cDNA ...
-
bioRxiv - Microbiology 2023Quote: ... 0.25 µl of Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA, USA), and 15.5 µl nuclease-free water ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were performed using Q5 high-fidelity DNA polymerase (NEB, cat. #M0491S) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... FANCJ genomic loci were amplified using high-fidelity Q5 DNA polymerase (New England Biolabs) and amplified fragments were subcloned using the Zero Blunt Topo PCR cloning kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Cell Biology 2022Quote: ... All PCR reactions were carried out with Q5 High-Fidelity DNA Polymerase (NEB #M0491). The cDNA of Pkd2 was amplified from the plasmid Pkd2-EGFP-N1 (Lab stock ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA inserts were PCR-amplified using NEBNext High Fidelity PCR Master Mix (NEB, M0541). The resulting PCR amplicons were purified using Ampure XP Beads and sequenced using the HiSeq 2500 system (Illumina ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and amplified using Q5 Host-Start High-Fidelity 2x Master Mix (New England Biolabs). PCR products were then size selected to remove adaptor-dimers below 200 bp using three subsequent size-selection rounds with a Select-a-Size DNA Clean & Concentrator Kit (D4080 ...
-
bioRxiv - Plant Biology 2022Quote: We performed all PCR cloning with Phusion High-Fidelity DNA Polymerase (New England BioLabs). Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... Reverse Transcription - PCR was performed using Q5 High-Fidelity DNA Polymerase (New England BioLabs), forward primer (ATGCTCGCCAGGATGCTCAACACTACG ...
-
bioRxiv - Microbiology 2023Quote: ... The flanking regions were amplified by Phusion High-Fidelity DNA polymerase (New England BioLabs) with the primers listed in Table S2.
-
bioRxiv - Molecular Biology 2023Quote: PCR amplification was performed using Q5 high fidelity polymerase (New England Biolabs, Hitchin, UK) and PCR screening was performed using GoTaq Flexi DNA polymerase (Promega ...
-
bioRxiv - Microbiology 2023Quote: CloneAmp HiFi PCR Premix (TakaraBio) and Phusion High-Fidelity DNA polymerase (New England BioLabs) were used for PCR reactions for all plasmid constructions ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl of High Concentration T4 RNA Ligase 1 (New England BioLabs, M0437)] at 23°C for 5 h ...