Labshake search
Citations for New England Biolabs :
1751 - 1800 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Clones were screened by PCR on extracted genomic DNA (NEB, T3010L) using the primer pair listed in Supplementary Table 2.
-
bioRxiv - Developmental Biology 2023Quote: ... The repair plasmids were either synthesized by Genscript Inc or by assembling PCR fragments with NEBuilder (New England Biolabs). Typical repair plasmids had homology arms of 500 bp to 1000bp ...
-
bioRxiv - Synthetic Biology 2023Quote: All PCRs were done using Q5 2X Master Mix (NEB, M0492L). Primers were designed on Benchling (https://benchling.com/ ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by PCR using Q5® high-fidelity DNA polymerase (NEB) with specific primers (Table S2) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were carried out using Phusion Master Mix from NEB in a final volume of 25 µL for diagnostic PCRs ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were digested with NheI and XhoI (New England Biolabs), gel-purified (Qiagen cat ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Genomics 2023Quote: ... The PCR reaction was carried out using 2X LongAmp Taq (NEB) with the following PCR parameters 94°C for 3 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification of edited loci using Q5 polymerase (NEW ENGLAND BIOLABS) with genotyping and NGS primers (Extended Data Table 3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were PCR-amplified (12.5 μL NEBNext High-Fidelity 2× NEB PCR Master Mix ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were amplified using Phusion High Fidelity DNA Polymerase (NEB) and pRS300 plasmid containing the miR319a precursor served as the template 89,90 ...
-
bioRxiv - Microbiology 2022Quote: ... primers for PCR were generated using automated software offered by NEB. pBAD vectors harboring the genes were linearized using the primers in inverse PCR and then incubated in 1X KLD mix provided with the kit for 5-10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich ...
-
bioRxiv - Bioengineering 2023Quote: ... elongatus was performed using colony PCR with Q5 DNA Polymerase (NEB), using primer pair NS1_Screen-F/NS1_Screen-R for transformations in neutral site 1 (NS1) ...
-
bioRxiv - Bioengineering 2023Quote: ... and all PCR reactions were performed using Q5 DNA polymerase (NEB).
-
bioRxiv - Cancer Biology 2023Quote: ... PCRs were carried out using High-Fidelity Q5 DNA Polymerase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... the PCR product was treated with 20U of DpnI (R0176L, NEB) for 1 hour at 37°C to eliminate the template ...
-
bioRxiv - Cell Biology 2023Quote: ... fragments were amplified using PCR (NEB Q5 highfidelity DNA polymerase, M0491) from other plasmids or A ...
-
bioRxiv - Genetics 2023Quote: ... which was PCR amplified with Q5 High-Fidelity DNA Polymerase (NEB) using primers that contained 50-nt homology arms to knockout gene locus ...
-
bioRxiv - Immunology 2023Quote: ... Promoter regions were PCR amplified using Q5 polymerase (New England Biolabs) from C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purified PCR products were 3′A-tailed using Taq polymerase (NEB) and cloned into TOPO TA-cloning vector (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers purchased from Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were performed with Q5 polymerase (New England BioLabs, NEB), and the fragments were assembled using HiFi (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were performed with Q5 polymerase (New England BioLabs, NEB), and the fragments were assembled using HiFi (NEB ...
-
bioRxiv - Systems Biology 2023Quote: ... 25 μL NEBNext Q5 HotStart HiFi PCR Master Mix (NEB, M0543S), and nuclease-free water for a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs). Library quality was assessed using a TapeStation instrument ...
-
bioRxiv - Neuroscience 2023Quote: ... 25µL NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs), and 5µL of Nextera i5 and i7 indexed amplification primers (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL STAG_P701_NEX (10 uM) ...
-
bioRxiv - Genomics 2023Quote: ... 50 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 2.5 µL 10 μM STAG_iP7_a1 oligo (5’-CAAGCAGAAGACGGCATACGAGATATTTACCGCAGTGACTGGAGTTCAGACGT*G*T-3’) ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified PCR products were cloned into the pMiniT 2.0 vector (NEB) and transformed into DH10B high-efficiency E ...
-
bioRxiv - Genetics 2023Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB). The identity of all plasmids was confirmed by Sanger Sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was ligated using T4 ligase (New England Biolabs) and transformed into E ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested with ClaI and XbaI (New England Biolabs) and inserted into pcDNA3-TTP-myc-his vector backbone digested with the same restriction enzymes.
-
bioRxiv - Plant Biology 2023Quote: ... MpGDI2 (Mp6g05010) and MpNAC7 (Mp6g02620) by PCR using Phusion polymerase (NEB). Arabidopsis Bobber1 (At5g53400 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCRs were performed with Q5 High-fidelity DNA polymerase (NEB, M0491L) plus GC buffer with the following reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S), 36.9 μL nuclease-free water and 2.5 μL of 10 μM sample index N (10x Genomics ...
-
bioRxiv - Bioengineering 2024Quote: ... All PCRs were performed using Q5 High-Fidelity DNA Polymerase (NEB).
-
bioRxiv - Microbiology 2023Quote: ... PCR amplification was with high-fidelity Phusion polymerase (New England Biolabs). Constructs were verified by colony-PCR using Taq polymerase followed by DNA sequencing (performed by Eurofins-GATC Biotech).
-
bioRxiv - Microbiology 2023Quote: ... PCRs were performed with Hot Start Taq DNA Polymerase (NEB, M0495L). IGR delVG bands were separated on a 2% agarose gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting PCR product was ligated (T4 Ligase, New England Biolabs) with AhdI-digested (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting PCR product was digested with AgeI and XbaI (NEB) and then ligated into the pattB-13xLexAop2EGFP plasmid (Coutinho-Budd ...
-
bioRxiv - Bioengineering 2023Quote: ... PCRs were performed with Q5 ® High-Fidelity DNA polymerase (NEB). PCR products were confirmed on a 0.8% agarose gel and purified using Wizard® SV Gel and PCR Clean-Up kit (Promega) ...
-
bioRxiv - Molecular Biology 2023Quote: ... usingn Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The target PCR products were mixed with the same volume of 1 × loading buffer (contained SYBR green) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and subjected to library construction PCR using Q5 HF mastermix (NEB), which was size selected using nondenaturing PAGE and recovered by ethanol precipitation ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR reactions were composed of 10 µL Q5 reaction buffer (NEB), 1 µL 10 mM dNTPs (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... All PCR steps were carried out using Q5 DNA polymerase (NEB).
-
bioRxiv - Plant Biology 2023Quote: ... PCR amplicons were ligated with AgeI- and XhoI- (New England BioLabs) linearized pEAQ-HT vector27 using HiFi DNA assembly mix (New England BioLabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Duplex PCR was performed using Q5 Hotstart 2x Master Mix (NEB) with final primer concentrations of 0.5uM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... by reverse PCR and blunt end ligation with KLD (NEB M0554S). Subsequently ...