Labshake search
Citations for New England Biolabs :
1651 - 1700 of 10000+ citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... qRT PCR was performed using Luna Universal qPCR master mix (NEB) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... while colony PCR was carried out using Taq Polymerase (NEB, M0270L). All plasmids were assembled using Gibson Assembly (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products (250 ng) were incubated with 2U of T7EI (NEB) in 1x NEBuffer 2 for 15 min at 37°C and analyzed by agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... PCR products were digested with DpnI (New England Biolabs, MA, USA) and purified using the EZNA Cycle Pure Kit ...
-
bioRxiv - Microbiology 2019Quote: ... Following PCR using Q5 DNA-polymerase (New England Biolabs, Ipswich, MA) and the BR_83/BR_84 primer pair ...
-
bioRxiv - Molecular Biology 2019Quote: ... Half of the recovered cDNA was PCR-amplified (Q5 polymerase, NEB) using custom sequence-indexed oligonucleotide primers with the following cycle numbers ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR amplicons were barcoded employing LongAmp Taq (New England BioLabs®). The ends of pooled DNA fragments were repaired employing the NEBNext End repair / dA-tailing Module (New England BioLabs®) ...
-
bioRxiv - Genetics 2019Quote: ... and the hybridized PCR products were digested with T7EN I (NEB) for 15 min and separated with a 2% agarose gel ...
-
bioRxiv - Genomics 2019Quote: ... and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB). Amplification was carried out using the following program ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR products were cloned into Lentiviral vector by Gibson Assembly (NEB) and purified with Agencourt AMPure XP SPRI beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng input and the primers P5_Seq_Luc_F and P7_Ind_#_Han or P7_In_####_Han ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) was used with 0.5 ng cDNA and the primers P5_Seq_Luc_F and P7_Ind_##_Han ...
-
bioRxiv - Developmental Biology 2019Quote: ... The PCR product was digested with the restriction enzyme HpyAV (NEB) to distinguish heterozygous and homozygous mutants.
-
bioRxiv - Biophysics 2019Quote: ... 96 × 50 ul PCR reactions in 1 × ThermoPol reaction buffer (NEB) were prepared using template (0.01 ng µL-1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... PCRs were performed with Q5® High-Fidelity DNA Polymerase (NEB) for at least 30 cycles ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The PCR products were treated with DPN1 (New England Biolabs inc.) and purified using the Agencourt AMPure XP system ...
-
bioRxiv - Molecular Biology 2019Quote: All PCR reactions were performed with Q5 polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... was amplified by PCR using Phusion High-Fidelity DNA Polymerase (NEB). DNA fragments for the IDR of EWS (residues 47-266 ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR fragments were digested with XhoI (New England BioLabs, USA) and NdeI (New England BioLabs ...
-
bioRxiv - Neuroscience 2019Quote: ... cleaved fragments were amplified by PCR using Q5 DNA polymerase (NEB) and cloned in pCR™4Blunt-TOPO® vector according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2020Quote: ... and NEBNext High-Fidelity 2X PCR Master mix (New England Biolabs) with 12 cycles ...
-
bioRxiv - Genomics 2020Quote: ... 25 µl 2x NEBNext High-fidelity PCR mix (New England Biolabs), and 15 µl H2O ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: ... The 25□µL final reaction volume contained 1X PCR Buffer (NEB), 3□mM MgCl2 ...
-
bioRxiv - Genetics 2020Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs M0530). Plasmids were digested with restriction enzymes at 37°C for 2-16hrs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR amplification steps were done using Q5 polymerase (NEB, M049L) and TOP10 chemically competent E ...
-
bioRxiv - Genomics 2021Quote: ... and 25 µl 2x NEBNext Hi-Fi PCR mix (NEB, USA) per reaction ...
-
bioRxiv - Physiology 2021Quote: ... Each PCR product was run alongside a 100bp DNA ladder (BioLabs) compared with positive and negative controls.
-
bioRxiv - Microbiology 2021Quote: ... Purified PCR product was digested with BsaHI RE enzyme (NEB, UK), as per the manufacturer"s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA sequence was PCR amplified using Phusion enzyme (NEB, M0530S) and appropriate primers with overhangs for Not1 and Kpn1 restriction enzymes (sequences given in Supplementary Table 2) ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR was performed on cDNA using Q5 High-Fidelity Polymerase (NEB). The K1 ORF was amplified using primers M1_F1 or M1_F5 and M1_R6 (Table S3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments were amplified using Q5 polymerase (New England Biolabs, NEB). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments were amplified using Q5 polymerase (New England Biolabs, NEB). DNA fragments were isolated using the Qiaprep spin miniprep kit (Qiagen) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The 2810-bp PCR product was phosphorylated with polynucleotide kinase (NEB) and circularized with T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... EJ5-GFP insertion was verified by PCR (OneTaq, New England Biolabs). CHO-K1 ATM+ was generated by transfecting a clonal population of CHO-K1 EJ5-GFP with a Cas9:tracrRNA:sgRNA ribonucleoprotein particle (Integrated DNA Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... all PCR products were generated with Phusion polymerase (New England Biolabs). All plasmids were sequence-verified.
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Plant Biology 2022Quote: ... the amplified PCR products were digested using DpnI (New England Biolabs) and transformed into DH5a competent cells ...
-
bioRxiv - Cell Biology 2021Quote: ... and used as DNA template for PCR with Phusion Polymerase (NEB) or Q5 Polymerase (NEB ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genetics 2021Quote: ... PCR fragments were amplified using Phusion polymerase (New England Biolabs (NEB), M0530 ...
-
bioRxiv - Genomics 2021Quote: ... The cDNA was PCR amplified with NEB Q5 HotStart polymerase (NEB) using splicing assay primers from IDT (AGACCCAAGCTGGCTAGCGTT forward ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with XbaI and XhoI enzymes (NEB) and cloned into the NheI and SalI sites of pCW57-MCS1-P2A-MCS2 (Hygro ...
-
bioRxiv - Immunology 2020Quote: ... PCR-amplified fragments were digested with NheI and SalI enzymes (NEB) and cloned into the NheI and SalI sites of a pCW57.1 vector ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were digested with restriction enzyme XmaI (New England Biolabs) and ligated with T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR step was carried out by Taq DNA polymerase (NEB) using forward primer identical to the adapter sequence (Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was PCR-amplified using either Phusion (New England Biolabs; NEB), Pfu (Agilent) ...
-
bioRxiv - Microbiology 2020Quote: PCR fragments were digested with BsaI or BsmBI restriction enzyme (NEB) to specific sticky end ...
-
bioRxiv - Immunology 2020Quote: PCRs were performed with Q5 High-Fidelity DNA polymerase (NEB, M0491L) in 8 parallel 50ul reactions with the following cycle conditions ...