Labshake search
Citations for New England Biolabs :
1551 - 1600 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... and Q5 Hot Start High-Fidelity 2X PCR Master Mix (New England Biolabs). The transcribed region had the following spacings ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR was performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491S) and primers harbouring overhangs for Gibson Assembly ...
-
bioRxiv - Bioengineering 2023Quote: ... Cassettes were confirmed by PCR using Q5® High-Fidelity DNA polymerase (NEB) with primers from IDT (Leuven ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by PCR amplification using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and indexed primers for Illumina sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was performed with a Q5 HotStart High Fidelity Polymerase (NEB, #M0493S), and resulting blunt-ended PCR products were cloned into a pCR-Blunt II-TOPO vector (Invitrogen Zero Blunt TOPO PCR Cloning Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5 mM EDTA pH 8.0) alongside RNA ladder (RiboRuler High Range; NEB, UK). Biotinylation was confirmed via RNA slot blot.
-
bioRxiv - Molecular Biology 2023Quote: ... and amplified and indexed with NEBNext High- Fidelity 2X PCR Master Mix (NEB) and custom primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... 29 μl of PCR master mix (2x Q5 high-fidelity master mix (NEB), 1 μM 2P universal forward primer ...
-
bioRxiv - Systems Biology 2023Quote: PCR amplifications were performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) and oligonucleotides for cloning were obtained from Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... were subjected to amplification using Q5 High-Fidelity polymerase (New England Biolabs, M0491L) for 15 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... 25 µl NEBNext High-Fidelity 2X PCR Master Mix (NEB, catalog number M0541S). In each 50 µl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... coli (High Efficiency) (Cat. No. C3019H, New England BioLabs, Inc, Ipswich, MA, USA) following the manufacturer’s instructions with a recovery time of either 1 hour (standard time ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 μL of T7 RNA Polymerase (High Concentration, New England Biolabs, Beverly, MA), 20 mM Tris-acetate pH 8.5 and DEPC-treated water ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Amplification was performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491L). The PCR reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR was performed at 30 cycles using Q5 High fidelity DNA Polymerase (NEB) at 0.02 U/µl according to further manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10.0 μl NEBNext High-Fidelity 2×PCR Master Mix (New England Biolabs, M0541S), 0.25 μl 100 μM PCR Index 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... All PCRs were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs).
-
bioRxiv - Synthetic Biology 2023Quote: ... Phusion® High-Fidelity PCR Master Mix with HF Buffer (New England BioLabs) was used to screen C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR amplification was performed using Q5® High-Fidelity DNA Polymerase (NEB #M0491L). The original vector was digested with the restriction enzyme DpnI (NEB #R0176S ...
-
bioRxiv - Genomics 2023Quote: ... using Q5 High-Fidelity PCR master mix with HF buffer (NEB Ipswich, MA) and PCR primers containing the T7 promoter sequence (Forward ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with Q5U HotStart High-Fidelity polymerase (New England Biolabs, M0515) as usual except a custom dNTP mix was used that contained dATP ...
-
bioRxiv - Cell Biology 2023Quote: ... and T2A-GFP were amplified with Phusion High-Fidelity DNA Polymerase (NEB, USA) using pLJC5-Tmem192-3HA (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... The oligonucleotide library was procured from GenScript (USA) and subsequently amplified employing the Phusion® High-Fidelity DNA Polymerase (NEB). The amplified product and pAX198 plasmids were digested using FastDigest Bpu1102I and FastDigest BstX1 (ThermoFisher) ...
-
bioRxiv - Genomics 2024Quote: ... Tagmented DNA was then amplified with Phusion high-fidelity PCR master mix (NEB) using 14 PCR cycles ...
-
bioRxiv - Microbiology 2024Quote: SV40 enhancer was amplified with PCR using Q5 High-Fidelity DNA Polymerase (NEB) from plasmid template ...
-
bioRxiv - Microbiology 2023Quote: PCR was performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) as per manufacturer’s instructions with the following primers ...
-
bioRxiv - Systems Biology 2024Quote: ... For all the PCR amplifications in this study Q5 high fidelity polymerase (NEB) was used according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: ... PCRs were carried out using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Following DpnI digest and PCR purification ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.02 U/µl of the Q5 High Fidelity DNA polymerase (New England BioLabs) and 1 µl of the template ...
-
bioRxiv - Cell Biology 2024Quote: ... and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB). The splicing efficiency is monitored using RT-PCR with primers located on two adjacent exons ...
-
bioRxiv - Molecular Biology 2024Quote: ... and amplified with 25 PCR cycles by Phusion High-Fidelity DNA polymerase (NEB) and adaptor specific primers carrying Illumina p5 and p7 flow cell binding sequences ...
-
Synthetase and Hydrolase Specificity Collectively Excludes 2’-Deoxyguanosine from Bacterial AlarmonebioRxiv - Microbiology 2024Quote: ... All PCR reactions were performed using the Q5 High-Fidelity DNA Polymerase (NEB) kit following the instructions enclosed ...
-
bioRxiv - Microbiology 2024Quote: ... were PCR-amplified by Q5® High-Fidelity DNA Polymerase (New England Biolabs) using plasmid L5 attB::Pleft*mScarlet/mWasabi (Addgene plasmids 169410 and 169409 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Q5 High-Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA, USA). RT-PCR protocol was involved in 35 cycles of PCR at 98°C for 10 sec ...
-
bioRxiv - Cell Biology 2024Quote: ... using Phusion High-Fidelity DNA polymerase and Taq DNA ligase (New England BioLabs). The reaction took place at 50=°C for 30=min ...
-
bioRxiv - Biochemistry 2024Quote: ... Targeted regions were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with target-specific primers containing NGS barcodes ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Physiology 2020Quote: RNA was extracted from cultured cells or tissue (∼10 mg) stored in RNALater® using Monarch® Total RNA Miniprep Kit (New England BioLabs). For maximal RNA recovery ...
-
bioRxiv - Microbiology 2021Quote: ... were cloned into the pCR-Blunt-II vector using the PCR Blunt Topo kit according to the manufacturer’s instructions and transformed into 10-beta CaCl2-chemically competent bacteria (originally NEB, generated in-house). Following amplifications of colonies and purification of plasmids using a QiAprep Mini kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μL of factor mix (with RNA polymerase, and transcription/translation factors in 10 mM Mg2+) from the PURExpress® Δ Ribosome Kit (New England Biolabs). The reaction buffer was based on Shimizu et al ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were PCR amplified from genomic DNA of yeast strain BY474129 and cloned together with the bidirectional inducible Gal1-10 promoter into the PCR amplified pRSII42B backbone with OZL14 and OZL15 via Gibson assembly30 using NEBuilder Kit (NEB, catalog E2621). MMR-DN mutant genes were subsequently generated via site-directed mutagenesis using either Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and 10-12 day adult TRAP libraries were prepared with the NEBNext Ultra RNA library Prep Kit for Illumina (NEB, product E7530S). ChIP-seq libraries were prepared using the NEBNext ChIP-seq Library Prep Master Mix Set for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Up to 10 ng of cDNA was used for the Illumina sequencing library construction using NEBNext® Ultra™ DNA Library Prep Kit (NEB). Paired ends sequencing was performed on NextSeq 500 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... and PCR enrichment of adapter-ligated DNA was performed for 10 cycles using NEBNext® Ultra™ DNA Library Prep Kit (New England Biolabs). Amplified libraries were purified with 0.7x SPRIselect beads and sequenced with MiSeq Reagent Kit v3 ...