Labshake search
Citations for New England Biolabs :
1551 - 1600 of 10000+ citations for Cow WAP kazal immunoglobulin kunitz and NTR domain containing protein 2 WFIKKN2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 50mM Tris (pH 8.5-8.8)) containing protease and phosphatase inhibitors (cOmplete Mini, PhosSTOP, Roche; 2mM Sodium Orthovanadate, NEB), sonicated to shear chromatin and centrifuged to remove cellular debris ...
-
bioRxiv - Molecular Biology 2020Quote: ... EcoRV de-staining buffer (deionized water containing 1X cut-smart buffer and 200 units of EcoRV (NEB, #R3195S) in 500ul) ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNase I de-staining buffer (PBS containing 1X DNase buffer and 20 units of DNase I (NEB, #M0303) in 500ul) ...
-
bioRxiv - Microbiology 2021Quote: ... Transposon-containing fragments were enriched by PCR using ComP7 primers ComP5 using Phusion DNA polymerase (New England Biolabs) in a 20-cycle reaction ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR for each sample was performed in 50µl total volume: containing 0.5µl Q5 High-Fidelity DNA polymerase (New England Biolabs, USA), 10µl 5X Q5 buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... streptavidin tips were incubated overnight in 50 mM ammonium bicarbonate containing 1,000 units PNGase F (New England Biolabs) at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... 1uL of the oligo mix was added to a master mix containing 1x T4 ligase buffer (NEB M0202M), 0.5 uL T4 PNK (NEB M0201L ...
-
bioRxiv - Biochemistry 2021Quote: ... fully assembled complexes containing His-Rpn12 and MBP-Rpn6 were purified using a HisTrap and amylose resin (NEB), and cleaved with HRV-protease ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer ...
-
bioRxiv - Genomics 2021Quote: ... in a 25 μL reaction containing 1X PNK buffer and 15 units of polynucleotide kinase (New England Biolabs) by incubating at 37°C for 45 minutes ...
-
bioRxiv - Immunology 2020Quote: ... before amplification with Illumina adapter-containing primers (Nextera i7 indices) and NEBNext Ultra II Q5 Master Mix (NEB) as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in Fast AP Master Mix (1x Fast AP Buffer containing 80U RNase Inhibitor (M0314, NEB), 2U TURBO DNase (AM2238 ...
-
bioRxiv - Immunology 2021Quote: ... and second strand synthesis was carried out by resuspending beads in a master mix containing Klenow Fragment (NEB), dNTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Microbiology 2022Quote: ... pRS1 containing the YohP-MS2-6xbs coding sequence was first linearized by EcoRI restriction digest (NEB, Frankfurt, Germany). In vitro transcription was performed using AmpliScribe T7-Flash Transcription kit (Lucigen Corp. ...
-
bioRxiv - Microbiology 2023Quote: NINL (1-702) containing an amino-terminal HaloTag was expressed in BL-21[DE3] cells (New England Biolabs), which were then grown until OD 0.4-0.6 and induced with 0.1 mM IPTG for 16 hr at 16°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... washed and incubated with T cell medium containing 5 μM (Snap-Cell Block S9106S, New England Biolabs, NEB) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Oligos containing the spacer sequence and Esp3I sticky ends were annealed and phosphorylated using T4 Polynucleotide Kinase (NEB) and purified using the Oligo Clean and Concentrator kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2023Quote: ... MYH7 fragment containing mutation was amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491L) and 500 nM forward and reverse primers (Table 3) ...
-
bioRxiv - Biophysics 2023Quote: ... p-SFG retroviral backbone containing an IRES-ΔCD19 reporter gene was linearized by NotI-HF (NEB, ref: R3189S) and XhoI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... and beads resuspended in a 50-µl PCR mix containing 1x NEBNext High-Fidelity PCR Master Mix (NEB) and 0.5 µM of Nextera Ad1_noMX and Ad2.X primers ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA containing one copy of the SIV gene was linearized using EcoR1 (New England Biolabs, Ipswich, MA) following their restriction digest protocol (New England BioLabs ...
-
bioRxiv - Physiology 2023Quote: ... The PCR was performed in a total volume of 50 µl containing 1× HF buffer (New England BioLabs), 1 µl dNTP Mix (New England BioLabs) ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... The wash solution was then replaced with 1× T4 polymerase buffer containing 30 U T4 DNA polymerase (NEB) and incubated at 12 °C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli in vitro transcription were synthesized through a 200 µL PCR reaction containing 10x Taq Buffer (NEB, #B9014S), 250 µM dNTP Mix (NEB ...
-
bioRxiv - Biophysics 2023Quote: A Tandem HaloTag plasmid containing the HaloTag-GTGSGSGS-HaloTag cDNA sequence was built via Gibson Assembly (NEB, (62)) of two HaloTag genes ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were resuspended in Rnase H reaction buffer containing 20 U/mL of Rnase H enzyme (NEB M0297S). Cells were incubated for one hour at 37 °C with gentle agitation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Such probes were generated by linearizing pDONR221-vectors containing the DsuzIR62a-coding sequences using NheI (New England Biolabs) following protocols described above ...
-
bioRxiv - Microbiology 2024Quote: ... TAP-PCR was performed in a total volume of 25 μL containing 0.25 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... The medium was then replaced with a fresh imaging medium containing 1 µM SNAP Cell Block (NEB, S9106S) to prevent the binding of residual SNAP dye to newly synthesized SNAP-tagged proteins ...
-
bioRxiv - Microbiology 2024Quote: ... 3 μL of a ligation mixture containing 0.01 U of Bst 2.0 DNA polymerase (NEB, Ipswich, MA, USA), 0.5 U of SplintR ligase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic region containing the CRISPR-edit was PCR-amplified using OneTaq polymerases in Standard Buffer (New England Biolabs). After PCR ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no ...
-
bioRxiv - Cell Biology 2024Quote: ... in a reaction solution containing 50 mM sodium phosphate (pH 7.5) and 1% NP-40 (B2704S, NE BioLabs) for 1 h at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... plasmid (Monarch® PCR mini-prep kit) and gel extraction kits (Monarch® DNA gel extraction kit) were also obtained from NEB and used according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...